WWW.KNIGA.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Книги, пособия, учебники, издания, публикации

 


Pages:   || 2 |

«РЕФЕРАТ Отчет 80 с., 1 ч., 12 рис., 19 табл., 67 источников. РАК ЖЕЛУДКА, ПРОТЕОМНЫЕ МАРКЕРЫ, ЭКСПРЕССИЯ ГЕНОВ, ИММУНОГИСТОХИМИЧЕСКИЙ МЕТОД, КЛОНИРОВАНИЕ, АНТИТЕЛА ...»

-- [ Страница 1 ] --

РЕФЕРАТ

Отчет 80 с., 1 ч., 12 рис., 19 табл., 67 источников.

РАК ЖЕЛУДКА, ПРОТЕОМНЫЕ МАРКЕРЫ, ЭКСПРЕССИЯ ГЕНОВ,

ИММУНОГИСТОХИМИЧЕСКИЙ МЕТОД, КЛОНИРОВАНИЕ, АНТИТЕЛА

Объектом исследования являются протеомные маркеры

злокачественных опухолей желудка диффузного и интестинального типов.

Цель выполнения НИР. Идентификация наиболее информативных протеомных маркеров для диагностики, прогнозирования и послеоперационного мониторинга рака желудка (РЖ) интестинального и диффузного типа; создание высокочувствительных тест-систем для детекции идентифицированных маркеров в биологических образцах. Выполнение НИР должно обеспечивать достижение научных результатов мирового уровня, подготовку и закрепление в сфере науки и образования научных и научнопедагогических кадров, формирование эффективных и жизнеспособных научных коллективов.

Цель работы пятого этапа — производство высокоспецифичных поликлональных антител, тестирование их специфичности.

Проведена иммунизация кроликов пептидами–миметиками антигенных детерминант белков и а также PMEPA1 INHBА, рекомбинантным белком AKR1B10 (фрагмент G214-Y316). Проведен иммуногистохимический анализ парафиновых блоков с использованием полученных АТ. Осуществлялся мониторинг больных после лечения, сбор биологического материала и крови и проведение исследований по тестированию генной экспрессии методом ПЦР с обратной транскрипцией выбранных ранее белков, ассоциированных с РЖ, на дополнительных независимых выборках пациентов.

Результаты, полученные при проведении этапа работы.

Оптимизированы условия гетерологичной экспрессии и очистке рекомбинантного белка AKR1B10 (фрагмент G214-Y316) в клетках E. coli, установлено, что препарат белка гомогенен, а также имеет околонативную конформацию. Методами твердофазного пептидного синтеза получены пептиды-миметики антигенных детерминант белков PMEPA1 и INHBA, проведена конъюгация с белком-носителем (овальбумином) и иммунизация кроликов с целью получения специфической сыворотки. Получены кроличьи поликлональные сыворотки к коньюгатам и PMEPA1 INHBA, иммуноферментный анализ активности которых показал необходимый уровень иммунного ответа на пептиды-миметики. Получены хроматографические сорбенты на основе NHS-сефарозы с ковалентнопришитыми пептидами для выделения фракции, обогащенной антипептидными антителами. Выполнены эксперименты по очистке (в том числе и в полу-препаративном масштабе), подтвердившие высокую селективность данного метода. На срезах ткани рака желудка иммуногистохимическим анализом показано сродство иммунных сывороток к пептидам PMEPA1 и INHBA к продуктам в цитоплазме опухолевых клеток и в части элементов воспалительного инфильтрата.



Получены новые данные о снижении экспрессионной способности опухолевых клеток, преимущественно в группе с кишечным типом РЖ, по мере нарастания глубины инвазии в стенку органа в отношении Кi67, CDX2, MUC2, AKR1B10 и CypА. На независимой выборке подтверждены результаты о прогностическом значении экспрессии AKR1B10 в клетках железистоподобных структур РЖ. Пополнены коллекции замороженных парных образцов опухолевой и нормальной ткани и парафиновых блоков опухоли от больных РЖ, для которых есть сведения об отдаленных результатах лечения с глубиной наблюдения от года до 10 лет. Проведен анализ результатов мониторинга больных после лечения.

На увеличенной выборке подтверждены данные о повышении экспрессии генов INHBA и PMEPA1 в опухолях желудка, потенциальная значимость INHBA как сывороточного диагностического маркера и PMEPA как прогностического маркера при кишечном типе РЖ.

Представлен научно-технический отчет. Достигнуты заявленные значения программных индикаторов и показателей по подготовке и закреплению в сфере науки молодых научных кадров.

СОДЕРЖАНИЕ

ВВЕДЕНИЕ………………………………………………………………………. ОСНОВНАЯ ЧАСТЬ……………………………………………………………. 1 Производство высокоспецифичных поликлональных антител, тестирование их специфичности………………………………………………. 1.1 Оптимизация уровня экспрессии фрагмента белка AKR1B10………….. 1.2 Очистка и рефолдинг рекомбинантного фрагмента белка AKR1B10………………………………………………………………………… 1.3 Получение конъюгатов пептидов-миметиков антигенных детерминант и и проведение иммунизации лабораторных INHBA PMEPA животных……………………………………………………………………….... 1.4 Анализ активности полученных кроличьих поликлональных сывороток к пептидам-миметикам антигенных детерминант и INHBA PMEPA1, конъюгированных с овальбумином …………………………………………… 2 Иммуногистохимический анализ парафиновых блоков с использованием полученных АТ, отбор АТ для прогноза течения РЖ различных типов……………………………………………………………………………... Иммуногистохимическое исследование кроличьих поликлональных 2. сывороток к коньюгатам пептидов INHBA и PMEPA1 на препаратах рака желудка………………………………………………………………………….. 2.2 Сравнительный анализ экспрессии стандартных и выявленных в исследовании белковых маркеров в опухолях желудка интестинального и диффузного гистологических типов………………………………………… 2.3 Валидация прогностической значимости тестирования белка AKR1B в опухолях желудка кишечного типа на независимой выборке …………….. 3 Мониторинг больных РЖ после лечения, сбор биопсийного материала и крови.…………………………………………………………………………... 3.1 Характеристика больных с различными гистологическими типами рака желудка, обследованных на протяжении пятого этапа………………………. 3.2 Результаты мониторинга больных раком желудка……………………….. 3.3. Результаты тестирования инфицированности больных раком желудка H.pylori …………………………………………………………………………. 4 Проведение дополнительных исследований по тестированию экспрессии генов ряда белков ОТ-ПЦР в реальном времени в тканях РЖ, других опухолях и нормальных тканях.……………………………………………….. ЗАКЛЮЧЕНИЕ.…………………….……………….………….………………. СПИСОК ИСПОЛЬЗОВАННЫХ ИСТОЧНИКОВ.………..……….…………

ВВЕДЕНИЕ





Существующие на сегодняшний день в клинической практике инструментальные методы диагностики РЖ не всегда позволяют распознать заболевание на ранних стадиях, при этом в мире практически отсутствуют тесты, обеспечивающие эффективную раннюю диагностику путем детекции опухолеассоциированных биологических маркеров. Наибольший интерес среди таких биомаркеров представляют белки, достаточно стабильные в высокочувствительными иммунохимическими методами, не требующими многостадийных процедур. В настоящее время в клинической практике для послеоперационного мониторинга пациентов c РЖ используется ряд определенной прогностической значимостью, однако они имеют высокую перекрестную реактивность и неэффективны для ранней диагностики.

потенциальную диагностическую и/или прогностическую значимость некоторых секреторных белков, таких как NF2, NEK6, INHBA, CDH17, PDCD6 при раке желудка, однако необходимы дальнейшие исследования для подтверждения их клинической значимости [1].

аденокарциномами, которые по гистологическому строению подразделяют на интестинальный и диффузный типы, различающиеся по характеру клинического течения и прогнозу [2], а, следовательно, и патогенезу [3].

Наличие избирательной активности генов в различных по молекулярному патогенезу гистологических типах РЖ - диффузном и интестинальном, делает актуальной работу по планомерному поиску генов, белковые продукты которых могут служить маркерами ранней диагностики или прогноза клинического течения заболевания.

Для поиска потенциальных диагностических онкомаркеров обычно преимущественно синтезируемых в опухолях определенного типа, но не в нормальных тканях. Для обнаружения таких белков, ассоциированных, в частности, с РЖ, могут быть использованы следующие подходы: анализ уже имеющихся в открытом доступе баз данных генной экспрессии в опухоли желудка (которые содержат результаты исследования на микроматрицах и предоставляют данные одновременно о тысячах генов) и анализ генной экспрессии образцов опухолевой и нормальной ткани из собственных коллекций с использованием коммерческих микроматриц (Ramaswamy S et.

al., 2001). Достаточно продуктивным является исследование экспрессии белков методом сравнительного анализа протеома нормальной и опухолевой экспрессирующихся белков методом масспектрометрии и подтверждением различий в генной экспрессии (ОТ-ПЦР) или уровне синтеза белка (вестернблот) на коллекциях парных образцов опухолей и нормальных тканей от больных раком. [4, 5, 6, 1].

Главные цели проекта: Идентификация наиболее информативных послеоперационного мониторинга РЖ интестинального и диффузного типа;

создание высокочувствительных тест-систем для детекции идентифицированных маркеров в биологических образцах. Выполнение НИР должно обеспечивать достижение научных результатов мирового уровня, подготовку и закрепление в сфере науки и образования научных и научнопедагогических кадров, формирование эффективных и жизнеспособных научных коллективов.

Достижение заявленных целей требует решения следующих задач.

1. Идентификация потенциальных протеомных маркеров рака желудка различных гистологических типов.

2. Поиск белков со стабильным повышением синтеза в опухолях желудка.

3. Отбор диагностических и прогностических маркеров рака желудка.

4. Оценка эффективности детекции маркеров.

5. Создание и тестирование наборов для ранней диагностики и прогнозирования течения заболевания.

В процессе выполнения первого и второго этапов работы был проведен анализ научно-технической литературы, нормативно-технической документации и других материалов по теме проекта, выполнены патентные исследования, что позволило обосновать актуальность выбранного направления исследований. На базе клиники НИИ онкологии СО РАМН собраны парные образцы опухолей и нормальных тканей, полученных при интестинальным типами первично-диагностированного рака желудка.

Сформирован банк образцов крови (сывороток), а также тканей в парафиновых блоках. Все образцы тканей снабжены полной клинической документацией и охарактеризованы гистологически, диагноз подтвержден.

Сформирован банк данных парафиновых блоков (от 120 пациентов с прослеженной историей после лечения).

На основе комплексного подхода, включающего использование известных и оригинальных алгоритмов биоинформатического анализа (по базам данных dbEST, SAGE и Oncomine, содержащих сведения об изменении уровня мРНК и микроРНК при различных патологических состояниях), литературных источников, собственных результатов двумерного электрофореза с последующей массспектрометрией, был выявлен ряд белков, ассоциированных с раком желудка. Потенциальные маркеры отбирались по изменению (повышению или понижению) уровня генной экспрессии в опухолевой ткани по сравнению с парной нормальной слизистой не менее, чем в 2 раза, а также по представленности измененного уровня экспрессии по меньшей мере в 50% исследуемых парных образцов.

Подтверждение стабильного повышения генной экспрессии и синтеза выбранных потенциальных белковых маркеров в опухоли по сравнению с нормальной слизистой желудка было проведено методом ПЦР в реальном времени с обратной транскрипцией.

В результате проведенного анализа, было выявлено статистически значимое повышение уровня экспрессии генов INHBA, циклофилина А, SPARC и PMEPA1 в опухолевой ткани по сравнению с нормой, а также понижение в опухоли уровня экспрессии гена AKR1B10. Белок SPARC был исключен из дальнейших исследований в связи с большим числом публикаций, свидетельствующих о его прогностической значимости. INHBA, потенциально могут детектироваться в биологических жидкостях организма, в том числе в сыворотке, с целью ранней диагностики. Однако речи о диагностической значимости AKR1B10 не может идти в связи со снижением его экспрессии в опухолях желудка, а повышение циклофилина А показано для целого ряда злокачественных новообразований, что свидетельствует о его неспецифичности. Поскольку повышение экспрессии INHBA в раке желудка наблюдается независимо от стадии, и он является растворимым, актуальны исследования по определению его диагностической значимости.

На третьем и четвертом этапе исследования была проведена оценка прогностической значимости нескольких белков по их экспрессии в ткани опухоли in situ иммуногистохимическим методом с использованием коммерческих антител и сопоставление уровня экспрессии этих белков с клинико-патологическими параметрами развития опухоли, а также с результатами отдаленного наблюдения после лечения (учитывалось появление рецидивов и отдаленных метастазов, характеризующих опухолевую прогрессию). Для AKR1B10 и циклофилина А была показана связь с отдаленным метастазированием, что свидетельствует о их прогностическом значении. Мембрано-ассоциированный белок PMEPA1, существенное повышение которого было отмечено для рака желудка интестинального типа, в связи с его вовлеченностью в патогенетически важные механизмы опухолевой прогрессии и практическим отсутствием данных в литературе, представляет интерес для дальнейших исследований.

Для валидации диагностической и прогностической значимости указанных белков предполагается создание поликлональных высокоаффинных антител, обладающих высокой чувствительностью детекции соответствующих антигенов.

последовательностей, соответствующих выбранным фрагментам потенциальных протеиновых маркеров рака желудка (INHBA, AKR1B10), на основе сравнительного биоинформатического анализа аминокислотных последовательностей, в плазмидные векторы систем pQE и pET. Был осуществлен скрининг различных систем экспрессии рекомбинантных белков, для выбора оптимальной, способной обеспечить наибольший выход и правильный фолдинг целевых белковых фрагментов.

В рамках решения запланированных на 5-й этап задач проведены следующие исследования:

тестирование их специфичности.

использованием полученных АТ, отбор АТ для оценки прогноза течения РЖ разных типов.

3. Мониторинг больных после лечения, сбор биологического материала и крови.

4. Проведение дополнительных исследований по тестированию генов ряда белков ОТ-ПЦР в реальном времени в тканях РЖ, других опухолях и нормальных тканях.

Все вышесказанное определило проведение исследований, результаты которых представлены в отчете. В исследованиях активное участие принимали студенты и аспиранты Томского государственного университета и Сибирского государственного медицинского университета. Полученные новые сведения включены в образовательные программы обучения студентов, программы последипломного образования ординаторов и аспирантов, выполняющих квалификационные работы по онкологии, патофизиологии, биохимии, иммунологии, программы научно-практических семинаров и конференций для молодых ученых и специалистов практического здравоохранения региона Сибири и Дальнего Востока.

ОСНОВНАЯ ЧАСТЬ

1 Производство высокоспецифичных поликлональных антител, тестирование их специфичности 1.1 Оптимизация уровня экспрессии фрагмента белка AKR1B В проведенной на предыдущем этапе пилотной серии экспериментов нами была показана возможность наработки фрагмента белка AKR1B10 в количествах, необходимых для дальнейшей иммунизации лабораторных животных. Необходимость проведения оптимизации уровня экспрессии вызвана рядом факторов. Так, при суперсинтезе гетерологичных белков в клетках E. сoli, в таких количествах, что целевой белок начинает образовывать тельца включения, бактериальные клетки находятся в состоянии стресса. Как правило, в таких условиях бактериальная культура практически не растет после индукции синтеза целевого белка. Кроме того, в условиях стресса, накапливающиеся в тельцах включения белки могут иметь “неправильно” модификации, что приведет к образованию отличной от нативной стуктуры белка и сделает невозможным его детекцию в биологическом материале.

На данном этапе нами были проведены работы по оптимизации уровня экспрессии фрагмента AKR1B10 посредством подбора оптимальной среды и условий культивирования, а также условий индукции. Были рассмотрены два индуктора синтетический аналог лактозы, ИПТГ в различных концентрациях, и сама лактоза. Были протестированы среды: LB, SOC (среда SOB с добавлением глюкозы в качестве энергетического субстрата), Terrific Broth (среда с повышенным содержанием питательных компонентов), M (среда с ионами магния, кальция, фосфатами, небольшим количеством глюкозы и тиамина).

Единичная колония штамма BL21(DE3)[рЕТ21a-AKR1B10] пересевалась в пробирку с 5 мл среды с добавлением 100 мкг/мл ампициллина и культивировалась в течение 12-и часов при 37С и встряхивании при 250 rpm. Предварительно измерили оптическую плотность ночных культур, минимальное значение равное 0,2 О.П. соотвествовало культуре, выросшей на среде M9, в дальнейшем, на данной среде был отмечен самый медленный рост клеточной культуры. Наибольшие показатели роста были отмечены в бактериальной культуре, выросшей на среде Terrific Broth. Затем, 5 мл ночной культуры переносили в колбу с 45 мл среды с 100 мкг/мл ампициллина. Клетки культивировали при 37С и встряхивании при неплотно закрытой крышке до значения оптической плотности 0,8 о.е., после чего в культуру добавляли ИПТГ (в дипазоне концентрации 0,1-1 мМ). И далее культивировали до тех пор пока изменение оптической плотности культуры не достигнет 1,3 единиц ОП.

Рисунок 1 – Накопление целевого продукта в штамме BL21(DE3) [рЕТ21a-AKR1B10] при индукции 0,5 мМ ИПТГ Раннее добавление ИПТГ (0,5 о.е.) не было оптимальным, так как сильно ингибировало дальнейший рост культуры. ИПТГ вносили до конечной концентрации 1 мМ, т.к. меньшие количества (0,1 мМ) не позволяли достичь необходимого уровня накопления продукта, а большие количества (более 2 мМ) значительно ингибировали рост культуры при том же уровне продукта (рисунок 1). Несмотря на проведенную оптимизацию индукции синтеза фрагмента AKR1B10 с помощью синтетического аналога лактозы, нам не удалось получить достаточного количества продукта для дальнейшей иммунизации лабораторных животных. В связи с этим, для последующих работ, в качестве индуктора синтеза целевого белка использовали лактозу. Для лактозы точка индукции специально не подбиралась, так как пока в культуральной среде содержится глюкоза, лактоза не утилизируется. Одного процента лактозы было не достаточно для полной индукции того количества бактериальной культуры, которое накапливалось на момент индукции. Кроме того, лактоза для клеток является не только индуктором, но и источником углерода. С другой стороны, при добавлении лактозы не наблюдалось значительного изменения характеристик роста культуры и количества продукта по сравнению с добавлением 2% лактозы. Таким образом, оптимальным количеством для индукции бактериальной культуры является 2% лактоза (рисунок 2).

Рисунок 2 – Накопление целевого продукта в штамме BL21(DE3) [рЕТ21a-AKR1B10] при индукции 2% лактозой Полученную после культивирования биомассу клеток осаждали центрифугированием при 6000 об/мин в течение 10 мин. Тельца включения, полученные после разрушения биомассы с использованием ультразвуковой установки (PT=30 sec; DT=1min 30s; TT=4 min; 6,0), последовательно отмывали буфером с 2M мочевиной, затем буфером с детергентом Triton Xи центрифугировали при 15 000 об./мин. Отмытые тельца включения AKR1B10 хранили в замороженном виде при -80°С. Для растворения телец включения использовали различные комбинации денатурирующих агентов:

20 мМ Трис-HCl с 6M изотиоционат гуанидина; 20 мМ Трис-HCl с 6M изотиоционат гуанидина и 10 мМ ДТТ; фосфатно-солевой буфер с 8M мочевиной. Несмотря на то, что гуанидин является более сильным хаотропным агентом, наиболее эффективное растворение телец включения наблюдалось при использовании 8M мочевины.

1.2 Очистка и рефолдинг рекомбинантного фрагмента белка AKR1B Дальнейшую очистку полученного фрагмента целевого белка проводили при помощи аффинной хроматографии на сорбенте Ni-NTA (“Qiagen”). Неспецифически связавшиеся с сорбентом белки отмывали буфером, содержащим 100 мМ имидазола, после чего целевой белок элюировали с помощью того же буфера, содержащего 250 мМ имидазола (рисунок 3).

Ренатурация полученного рекомбинантного белка были проведена с применением методов диализа с понижением градиента концентрации мочевины и адсорбционной ренатурации в двухбуферной системе.

Рисунок 3– Электрофорез фракций, полученных после аффинной Во время диализа денатурированный белок достаточно длительный промежуток времени находится в растворе, при этом концентрация денатурирующего агента снижается постепенно. Скорость образования интермедиатов, а затем и ренатурированного белка в нативном состоянии увеличивается по мере снижения концентрации денатуранта. Однако при этом увеличиваются также скорости агрегации и некорректного фолдинга. В частности, агрегация усиливается при невысокой скорости фолдинга, так как низкие и промежуточные концентрации денатуранта могут быть недостаточны для поддержания интермедиатов в растворенном состоянии.

Кроме того, некоторые денатурированные полипептиды могут проникать через мембрану в буферный раствор. По этим причинам в нашей работе ренатурация полученного рекомбинантного белка были проведена с применением двух различных методов: диализа с понижением градиента концентрации мочевины и адсорбционной ренатурации в двухбуферной системе, являющейся крайне эффективной стратегией для предотвращения агрегации целевого белка при понижении концентрации денатурирующего агента.

Для проведения диализа, денатурированный в 8 М мочевине белок AKR1B10 помещали в заранее смоченную в фосфатно-солевом буфере диализную камеру (объемом 2,5 мл). Затем камера погружалась в 8 М раствор мочевины с последующим ежесуточным понижением концентрации денатурирующего агента до 2 М включительно. На следующем этапе камеру погружали в 1 М раствор мочевины с 0,4 М L-аргинина. Последние сутки диализ протекал в 0,4 М растворе L-аргинина. Полученный раствор целевого белка до 0,5 мг/мл.

Нами был также применен метод адсорбционной ренатурации заключавшийся в адсорбции молекул денатурированного белка на твердом пространственное разделение молекул друг от друга во время ренатурации.

Ренатурация происходила одновременно с элюированием целевого фрагмента с колонки. Достижение необходимого эффекта при использовании адсорбционной ренатурации напрямую зависит от взаимодействий белка с матрицей. Наиболее предпочтительными являются аффинные взаимодействия, поскольку они обеспечивают связывание белка с матрицей через специфические домены, в то время как основная часть биомолекулы остается доступной и может ренатурировать. Гибридные партнеры, такие как полигистидиновый таг или целлюлозосвязывающий домен, обеспечивают высокую степень связывания даже в присутствии денатурирующих агентов.

На Ni-NTA колонну, уравновешенную 8 М мочевиной, наносили образец рекомбинантного фрагмента AKR1B10, растворенный в 8 М мочевине. После адсорбции образца концентрацию мочевины в колонне постепенно снижали при промывке буферным раствором, содержащим 8 М мочевину и 25 мМ имидазола (для отмывки неспецифически связанных белковых фрагментов), растворенные в ФСБ. Раствор для ренатурации содержал 0,5 М мочевину и 300 мМ имидазола. Постепенное понижение концентрации денатурирующенго агента при промывке колонки данным буфером сопровождалось увеличением градиента элюирующего агента и снятием с колонки ренатурированного фрагмента AKR1B10.

Для подтверждения формирования корректной укладки полипептидной цепи был проведен анализ с применением КД-спектрополяриметра J- (Jasco), белок в концентрации 20 мМ был переведен в 10 мМ калийфосфатный буфер, рН 7 путем диализа. Измерение проводили в диапазоне 190-260 нм. Основываясь на имеющихся данных о трехмерной структуре выбранного фрагмента AKR1B10 [7] нами было установлено, что содержание альфа-спиралей в целевом белке составляет 47%, а бета-складчатых листов 8%. Экспериментально было установлено, что после рефолдинга (только в случае адсорбционной ренатурации) альфа-контент 44.4, а бета-контент (http://www.ogic.ca/projects/k2d2/), ошибка определения составила 0,23% (Рисунок 4).

(deg·cm2·dmol-1) Рисунок 4– Результаты КД-спектрополяриметрического анализа препарата AKR1B10_G214-Y316 (зеленым показаны экспериментально полученные данные, красным данные предсказания по аминокислотной Полученный препарат белка был сконцентрирован с применением центрифужных концентраторов Amicon-15 (Millipore) до 0,75 мг/мл, стерилизован фильтрацией через 0,22 мкм фильтр. Полученный раствор был использован для дальнейшей иммунизации лабораторных животных. Схема иммунизации будет описана ниже.

лабораторных животных Учитывая сложность работы с полноразмерными белками INHBA (трансмембранный хвостом), нами был осуществлен дизайн пептидов-миметиков антигенных детерминант с применением сравнительного анализа антигенных свойств, основываясь на нескольких алгоритмах предсказания [8]. Была детально последовательность, которая является наиболее конформационно-доступной формирования дисульфидных связей в биомолекуле.

YYDDGQNIIKKDI (INHBA)

WSKEKDKQKGHPL (PMEPA1) были получены методом твердофазного синтеза и очищены до 95% чистоты с применением обращено-фазовой хроматографии.

полученные синтетические пептиды были ковалентно пришиты к белкуносителю (овальбумину). Полученные конъюгаты были переведены в 20 мМ натрий-фосфатный буфер, рН 7.2 и сконцентрированы до 1 мг/мл, а затем эмульгированы в полном адьюванте Фрейнда (Sigma) [9,10,11].

Схема иммунизации состояла из следующих этапов:

День 1: забор доиммунной сыворотки, первая иммунизация в полном адъюванте Фрейнда;

День 28: вторая иммунизация в неполном адъюванте Фрейнда;

День 42: третья иммунизация в неполном адъюванте Фрейнда;

День 52: первый забор крови (~50мл. крови из кролика);

День 56: четвертая иммунизация в неполном адъюванте Фрейнда;

День 66: второй забор крови (~50мл. крови из кролика).

использованы в качестве продуцентов высокоспецифических антител и далее. Весьма интересным представляется разработка метода для препаративного удаления фракции IgG против белка-носителя с помощью адсорбции с овальбумином.

1.4 Анализ активности полученных кроличьих поликлональных сывороток к пептидам-миметикам антигенных детерминант INHBA и PMEPA1, конъюгированных с овальбумином Конъюгированные с овальбумином пептиды PMEPA1 и INHBA сорбировали в планшеты для ИФА высокой сорбционной емкости в концентрации 5 мкг/мл, по 100 мкл в лунки и инкубировались в течение ночи при комнатной температуре во влажной камере. После инкубации лунки троекратно промывали буфером, содержащим детергент. Далее в лунки вносили образцы сывороток полученных от животных, в различных разведениях, инкубировали 1 час на шейкере. После инкубации лунки троекратно промывали буфером, содержащим детергент. Затем вносили козьи анти-кроличьи антитела, конъюгированные с пероксидазой хрена (DAKO), и инкубировали 1 час на шейкере. Далее четырехкратно промывали буфером с детергентом, пять раз деионизированной водой. Хромогенную реакцию проводили с коммерческим раствором ТМБ (Sigma), для этого во все лунки вносили по 100 мкл субстратной смеси и инкубировали планшет в темноте в течение 15 мин. Для остановки реакции добавляли во все лунки по 50 мкл 0.1 М раствора H2SO4 и встряхивали на шейкере в течение 10 мин.

Детекцию результатов реакции проводили на планшетном ридере Мultiscan при длине волны 450 нм.

По предварительным данным из-за сильного сигнала на овальбумин не был обнаружен специфический ответ на пептиды. В связи с этим разведенную сыворотку перед ИФА предварительно инкубировали с избытком овальбумина. После этой процедуры фон на белок-носитель был практически нулевым. Было экспериментально установлено, что оптимальными рабочими разведениями для полученных поликлональных антисывороток являются 1:6000 (Рисунок 5).

Рисунок 5– Иммуноферментный анализ полученных поликлональных антисывороток против пептидов-миметиков антигенных детерминант Титры поликлональных антител на оба пептида достаточные и позволяют использовать их для дальнейшей очистки и выделения высокоаффинной фракции. Всего удалось получить по 40 мл сыворотки на каждый пептид.

использованием полученных АТ, отбор АТ для прогноза течения РЖ различных типов поликлональных сывороток к коньюгатам пептидов INHBA и PMEPA на препаратах рака желудка коньюгированных с овальбумином, были протестированы на срезах ткани иммуноферментного анализа показала, что титры поликлональных антител на оба пептида хорошие и позволяют использовать их для дальнейшей очистки. В настоящем разделе представлены данные ИГХ анализа ткани РЖ кишечного типа пациентов, для которых показано существенное (не менее, чем в 5 раз) увеличение генной экспрессии указанных белков, тестированное методом ПЦР с обратной транскрипцией.

Методы исследования. Для расправления срезов стекла со срезами помещают в термостат при 56С на 30 минут. Используется буфер для демаскировки комнатной температуры, которым заполняются контейнеры (2 шт.), по 200 мл буфера в каждом. Готовятся протоколы исследования (на листах-бланках нанесены эскизы стекол с полем для нумерации). Протоколы заполняются заранее и хранятся после исследования. Расположение самих срезов отмечается на эскизе стекла в момент нанесения пероксидазного блока. Промывочный фосфатный буфер, рабочее разведение антитела (обогащенной антителами сыворотки) готовится в день исследования, заранее. Далее, проводится депарафинизация срезов - стекла со срезами обрабатываются в 3 порциях ксилола при температуре 39С, по 10 минут в каждой. Затем стекла со срезами проводятся по спиртам (96) – 3 порции по 5 минут. Стекла помещают в дистиллированную воду на 5 минут.

Далее стекла помещают в контейнеры для демаскировки с цитратным буфером рН =6,0. Контейнеры со стеклами помещаются в программируемую барокамеру Паскаль (фирма «Дако»). Демаскировка проводится при 121°С минуты. Далее, барокамера остывает на 35 минут. Стекла промывают в фосфатном буфере, в 2 порциях по 5 минут. Срезы обводят гидрофобным карандашом и наносят реагент, блокирующий эндогенную пероксидазную активность (Peroxidase blocking reagent производитель фирма “Dako”) на минут. Помещают стекла со срезами в дистиллированную воду – 1 порция минут. Затем промывают стекла со срезами в фосфатном буфере - 1 порция 5 минут. Наносят первичные/специфичные антитела на 30 минут, при температуре 25С (рабочее разведение антител INHBA 1:450 и PMEPA 1:250).

Стекла со срезами промывают в промывочном фосфатном буфере – порции по 5 минут. Наносят полимерную систему визуализации производства фирмы “Dako” EnVision Flex, High pH на 30 минут при температуре 25С. Стекла со срезами промывают в промывочном фосфатном буфере – 2 порции по 5 минут. Далее, на 5 минут наносят раствор ДАБ производства фирмы “Dako”. Готовится перед применением. К 1 мл ДАБбуфера +1 капля ДАБ-хромогена (ДАБ-буфер и ДАБ-хромоген входят в состав набора “Dako”) – (появление окраски/ход реакции контролируется под микроскопом). Стекла со срезами промывают в водопроводной воде – минут и докрашивают гематоксилином в течение 6 секунд. Стекла с окрашенными срезами помещают в водопроводную воду на 10 минут, в порции спирта (96) по 5 минут, в 3 порции толуола по 5 минут и заключают в канадский бальзам. Препараты маркируются согласно протоколу.

Проведение оптимизации протокола с использованием разных разведений иммунной сыворотки позволило выбрать режим окрашивания при разведении сыворотки, обогащенной АТ к INHBA 1:450 и PMEPA1 Обнаружено выраженное сродство иммунных сывороток к клеточным элементам карциномы желудка кишечного типа (цитоплазматическое окрашивание) при негативной реакции стромальных элементов (рисунок 6, 7).

Рисунок 6 – Экспрессия ингибина в цитоплазме опухолевых элементов карциномы желудка кишечного типа и в клетках воспалительного Рисунок 7 – Экспрессия PMEPA1 в цитоплазме опухолевых элементов карциномы желудка кишечного типа и в клетках воспалительного Таким образом, представленные результаты свидетельствуют, что в испытуемых сыворотках находятся антитела, имеющие сродство к продуктам в цитоплазме опухолевых клеток и в части элементов воспалительного инфильтрата, при этом позитивной реакции стромальных элементов не отмечено.

2.2 Сравнительный анализ экспрессии стандартных и выявленных интестинального и диффузного гистологических типов Рак желудка является одним из наиболее часто встречающихся злокачественных новообразований и характеризуется высокими показателями летальности [12, 13]. Одним из принципов гистологической классификации рака желудка является деление опухолей на кишечный и диффузный типы [2]. Данные типы рака желудка имеют существенные отличия по ряду клинических, морфологических и экспрессионных параметров. Известно, что рак желудка диффузного типа чаще возникает у молодых пациентов, склонен к более агрессивному течению и более частому метастазированию [14,15].

Согласно современным представлениям, молекулярный патогенез интестинального и диффузного типов рака желудка, несмотря на целый ряд общих черт, существенно различается. Спорадические злокачественные новообразования желудка диффузного типа ассоциированы с нарушениями функционирования генов RUNX3, CDH1 и FGFR2/KSAM, CDKN2A [24, 25].

К характерным для спорадических новообразований желудка кишечного типа генетическим изменениям относятся инактивация гена HMLH1 и мутации CDX2 (сaudal type homeobox transcription factor 2) – транскрипционного фактора, вовлеченного в процесс дифференцировки эпителия в кишечнике, поджелудочной железе и желчных путях, а также в генах ps2, RARB, HER-2/neu и других. В ряде исследований была показана связь уровня экспрессии CDX2 с риском развития рака желудка [16, 17].

Обнаружилось, что экспрессия CDX2 была значительно снижена в образцах с неполной кишечной метаплазией, при которой экспрессируются оба желудочных муцина (MUC5AC и MUC6) и кишечный муцин (MUC2), в отличие от образцов с полной кишечной метаплазией, при которой экспрессируется только кишечный муцин (MUC2) [18, 19, 20, 21].

Экспрессия CDX2 при раке желудка была обратно пропорциональна экспрессии желудочных муцинов. Неполная кишечная метаплазия связана с более высоким риском развития рака желудка. Наблюдение снижения экспрессии CDX2 при неполной кишечной метаплазии, дисплазии эпителия желез и раке желудка позволило предположить, что CDX2 играет антиканцерогенную роль [23, 22 18]. CDX2 взаимодействует с генами опухолевой супрессии APC и E-cadherin, а также с bcl-2 [24, 25]. Потеря экспрессии CDX2 может быть сигналом прогрессии опухоли в случаях раннего рака желудка и рака с кишечным фенотипом [26, 16, 17].

При раке желудка кишечного типа чаще, чем при раке диффузного типа, отмечается экспрессия белка опухолевой супрессии р53, одного из ключевых регуляторов процессов репарации ДНК и апоптоза, выше экспрессия маркера пролиферации Ki-67 [27, 28, 29, 14].

Следует отметить, что данные различных авторов о возможности использования указанных маркеров апоптоза, пролиферации и клеточной дифференцировки для оценки прогноза клинического течения РЖ разных гистотипов не всегда согласуются между собой, и исследования в этом прогностических маркеров при раке желудка.

проведении 2D протеомного анализа и биоинформатического поиска были выявлены 2 гена, кодирующие потенциальные белковые маркеры рака желудка: циклофилин А и AKR1B10. При этом впервые были получены злокачественных новообразованиях желудка и нормальной слизистой при использовании парных образцов ткани одного и того же пациента, у больных раком желудка в российской популяции [5, 6, 30].

AKR1B10 – НАД(Ф)-зависимая оксидоредуктаза, участвующая в метаболическом пути ретиноевой кислоты, играющей важную роль в регуляции клеточной дифференцировки и осуществляющей ростсупрессивные эффекты в трансформированных клетках [31]. Циклофилин А (CypА, PPIA), относится к семейству иммунофилинов и играет важную роль в формировании компетентного фолдинга белков, хемотаксисе и сигнальной трансдукции. В последние годы получены данные о гиперэкспрессии CypA в злокачественных опухолях различных локализаций и его прогностическом значении, однако сведений о связи с раком желудка нами не найдено [32, 33]. В этой связи актуальным было сравнительное изучение экспрессии указанных белков и ряда известных маркеров у больных раком желудка разных гистотипов в сопоставлении с патогенетически значимыми признаками злокачественного процесса (клинико-морфологическими характеристиками).

Следует также особо отметить, что важное значение для оценки прогностической значимости потенциальных маркеров имеет стандартизация параметров опухолевого роста, характеризующих прогрессию. Одним из основных параметров прогрессии РЖ является глубина инвазии опухоли, однако при этом не учитываются возможные различия экспрессии в разных структурах паренхиматозного компонента опухоли. В то же время их оценка может существенно повысить информативность тестируемых маркеров. В настоящем исследовании представлены результаты сравнительной оценки экспрессии стандартных экспрессионных маркеров Ki67, p53, CDX2, MUC2, MUC5, а также белков циклофилина А и AKR1B в разных структурах паренхиматозного компонента опухоли у больных с различными гистологическими типами рака желудка.

Материалы. Исследован операционный материал от 107 больных раком желудка в возрасте от 31 до 82 лет, (средний возраст 58,5±10,7), стадии заболевания Т1-3N0-3M0, находившихся на лечении в отделении торакоабдоминальной онкологии НИИ онкологии СО РАМН с 2003 по 2009 гг.

Работа проведена с соблюдением принципов добровольности и конфиденциальности в соответствии с «Основами законодательства РФ об охране здоровья граждан» (Указ Президента РФ от 24.12.1993 № 2288), получено разрешение этического комитета института, от всех пациентов получено информированное согласие на включение материала в исследование. Больные не получали неоадъювантной химиотерапии. (61,8%) больным была проведена субтотальная дистальная резекция желудка, 38 (36%) - гастрэктомия, 1 (0,8%) – проксимальная резекция желудка, (0,8%) – панкреато-дуоденальная резекция, 1 (0,8%) – операция Льюиса.

Морфологическому исследованию подвергался операционный материал. Оценивалась ткань первичного опухолевого узла и все удаленные лимфатические узлы. Взятые образцы тканей помещались в нейтральный формалин. Материал проводился по стандартной методике и заливался в парафин. Срезы толщиной 5-6 мкм окрашивались гематоксилином и эозином.

устанавливался согласно классификации [2].

В паренхиматозном компоненте опухолей диффузного и кишечного типов выделялись железистоподобные, трабекулярные, солидные, криброзные структуры и дискретно расположенные группы опухолевых клеток, отмечалось наличие перстневидных клеток. Оценивалась глубина инвазии опухоли по отношению к толще стенки желудка разными типами опухолевых структур. В регионарных лимфатических узлах определялось наличие метастатического поражения.

Методы.

стандартной методике. При исследовании применялись антитела фирмы «Dako» к Ki67 (клон MIB-1, RTU, мышиные), фирмы «Novocastra» к р (клон CM1, рабочее разведение 1:150), к bcl2 (клон bcl2/100/D5, рабочее разведение 1:80), к CDX2 (клон АМТ28, рабочее разведение 1:100), к PPIA (циклофилин А) (рабочее разведение 1:1200), к MUC2 (клон FPM513, RTU, мышиные), к MUC5 (клон FPM488, RTU, мышиные). Для детекции моноклональные антитела, полученные в институте молекулярной биологии им. В.А.Энгельгардта РАН (НОУ-ХАУ, Протокол № 02.445.11.7354-4 от марта 2008 г.). Чувствительность антител в дот-блоте составила 100 пкг, в Вестерн-блоте – 100 пкг. Использовалось рабочее разведение антител 1:300.

Экспрессия всех маркеров оценивалась по процентному содержанию положительно окрашенных клеток в каждом варианте структур паренхиматозного компонента первичной опухоли на различной глубине инвазии. Число клеток с позитивной экспрессией изучаемого маркера определялось на 100 клеток в 10 полях зрения при увеличении х400.

Обработка полученных данных выполнялась с использованием пакета программ «Statistica 6.0». Применялся дисперсионный, корреляционный анализ по Спирмену, критерий 2. Обсуждаются результаты со значимостью различий при р 0,05 и с тенденцией различий при р 0,1.

Результаты и обсуждение. Было обнаружено 64 (60%) случая с кишечным и 43 (40%) случая с диффузным типом рака желудка. Больные с диффузным типом опухоли были моложе. Средний возраст этих пациентов составил 54,3±10,8 лет, в то время как у больных с кишечном типом новообразований он составил 61,7±8,9 лет (F=14,7; р=0,0002). Распределение больных по полу, стадии заболевания, размерам, локализации первичной опухоли, частоте лимфогенного метастазирования в изучаемых группах было одинаковым. В то же время, при диффузном типе рака желудка отмечалась тенденция к метастатическому поражению большего числа лимфатических узлов (соответственно: 5,5±4,1 и 9,7±11,9; F=3,4; р=0,07). Локорегионарные рецидивы и отдаленные метастазы выявлялись при кишечном и диффузном типах карциномы с одинаковой частотой.

Как уже упоминалось выше, новацией настоящего исследования явилось то, что определяемые экспрессионные параметры оценивались не только по отношению к опухоли в целом, но и в клетках, образующих разные структуры паренхиматозного компонента новообразования, располагающиеся на различной глубине инвазии. Оказалось, что пролиферативная активность опухоли, определяемая по проценту экспрессии Ki67, не различалась при кишечном и диффузном типе рака желудка (33,7±27,7 и 24,5±27,9, соответственно; р=0,21). При кишечном типе новообразования отмечалось снижение пролиферативной активности в клетках, формирующих железистоподобные структуры, при нарастании инвазии опухоли в стенку органа. Процент клеток, экспрессирующих Ki67, был выше в железистоподобных структурах, располагающихся в слизистой оболочке (33,7±22,7%), по сравнению с экспрессией в подобного рода структурах, находящихся в серозной оболочке (4,8±3,3%; р=0,02). При диффузном типе рака процент экспрессии Ki67 в мелких группах опухолевых клеток, находящихся в слизистой оболочке, был также выше (24,5±27,9%) по сравнению с этим показателем в аналогичных структурах, располагающихся в серозной оболочке (3,2±1,6; р=0,07).

Частота выявления случаев с позитивной экспрессией CDX2 не различалась при кишечном и диффузном типах рака желудка (95% и 93%, соответственно; р=0,86). Не различался и процент клеток с позитивной экспрессией CDX2 в анализируемых группах (31,6±16,9 и 27,5±16,7, соответственно; F=0,4; р=0,53). При кишечном типе рака желудка по мере увеличения глубины инвазии опухоли в стенку органа, снижался процент экспрессии CDX2 в железистоподобных структурах. Подобного рода закономерность определялась и в случаях с диффузным типом новообразования (таблица 7, 8).

Позитивная экспрессия bcl2 чаще наблюдалась при кишечном типе рака желудка в сравнении с диффузным (77% и 31%, соответственно; р=0,01).

Процент же клеток с позитивной экспрессией bcl2 не различался в исследуемых группах (0,55±0,5 и 0,7±0,4; р=0,24). Как при кишечном, так и при диффузном типе рака желудка выраженность экспрессии bcl2 не отличалась в разных вариантах опухолевых структур, находящихся на разной глубине инвазии (таблица 1, 2).

Позитивная экспрессия р53 чаще наблюдалась при диффузном типе рака желудка в сравнении с кишечным (100% и 72%, соответственно;

р=0,04). Процент опухолевых клеток, экспрессирующих р53, не различался при кишечном и диффузном типах рака желудка (27,2±33,3 и 34,2±32,3;

р=0,36). Как при кишечном, так и при диффузном типе рака желудка выраженность экспрессии р53 не отличалась в разных вариантах опухолевых структур с учетом глубины инвазии их в стенке желудка (таблица 1, 2).Частота встречаемости случаев с позитивной экспрессией MUC2 была одинаковой при кишечном и диффузном типах рака желудка (86% и 94%, соответственно; р=0,43), так же как и процент клеток, экспрессирующих MUC2 (19,4±11,8 и 18,1±16,9 соответственно). В случаях с кишечным типом формирующих железистоподобные структуры при нарастании глубины инвазии. При диффузном типе новообразования доля клеток, экспрессирующих MUC 2, была одинаковой в разных слоях стенки органа (таблица 1, 2).

Позитивная экспрессия MUC5 наблюдалась в 83% случаев при кишечном и в 88% случаев при диффузном типе рака желудка (р=0,73).

Процент экспрессии MUC5 не различался при кишечном и при диффузном типах рака желудка (39,0±30,9 и 57,2±30,2; р= 0,12). Ни при кишечном, ни при диффузном типах рака желудка не отмечено изменений процента экспрессии MUC5 при нарастания глубины инвазии в стенку органа (таблица 1, 2).

Во всех случаях при кишечном и диффузном типах рака желудка наблюдалась экспрессия протеина AKR1B10 в цитоплазме опухолевых клеток. У пациентов с кишечным типом рака желудка экспрессия протеина AKR1B10 в опухолевых клетках железистоподобных структур снижалась по мере нарастания инвазии опухоли в стенку желудка. В паренхиматозном компоненте диффузного рака желудка процент экспрессии протеина AKR1B10 в дискретных группах опухолевых клеток не зависел от глубины их расположения в стенке желудка (таблица 1, 2). Частота встречаемости случаев с позитивной экспрессией CypA не различалась у больных с кишечным и диффузным типами рака желудка (90% и 88%; р=0,88). При диффузном типе рака желудка процент экспрессии CypA был ниже в сравнении с экспрессией этого маркера в цитоплазме клеточных элементов карциномы кишечного типа (7,7±7,0 и 24,6±19,3; F=10,5; р=0,002). При раздельном изучении процента экспрессии CypA в каждом из вариантов опухолевых структур с учетом глубины инвазии выявлены следующие закономерности. Оказалось, что при кишечном типе рака желудка экспрессия CypA в опухолевых клетках железистоподобных структур снижается при нарастании глубины инвазии. В паренхиматозном компоненте при диффузном типе рака желудка процент экспрессии CypA в дискретных группах опухолевых клеток не зависел от глубины их расположения в стенке желудка (таблица 1, 2).

Таблица 1 – Процент клеток с экспрессией CDX2, bcl2, р53, MUC2, MUC5, AKR1B10, CypA в железистоподобных структурах опухоли на различной глубине инвазии у больных с кишечным типом рака желудка Таблица 2 – Процент клеток с экспрессией CDX2, bcl2, р53, MUC2, MUC5, AKR1B10, CypA в дискретных группах опухолевых клеток на различной глубине инвазии у больных с диффузным типом рака желудка Результаты проведенных исследований подчеркивают биологические различия кишечного и диффузного рака желудка. Часть полученных данных согласуется с описанными в литературе фактами: более молодой возраст и более выраженное лимфогенное метастазирование отмечается у пациентов с диффузным типом рака. В то же время мы показали, что у больных с диффузным типом РЖ чаще наблюдалась экспрессия р53 в клетках опухоли, чем у пациентов с кишечным гистотипом, тогда как для других маркеров – ki67, MUC5, MUC гистологического типа опухоли. Эти данные не согласуются с представленными в литературе о более выраженной экспрессии указанных маркеров в опухолях кишечного типа [27, 28, 29, 14].

Такие расхождения, скорее всего, связаны с тем, что в настоящем исследовании в группе с кишечной карциномой были представлены преимущественно случаи с умеренно и низкодифференцированными опухолями.

В настоящем исследовании получены новые данные о связи экспрессионной способности клеток опухоли с параметрами инвазивного роста опухоли. Обнаружена закономерность снижения экспрессионной способности опухолевых клеток, преимущественно в группе с кишечным типом новообразования, по мере нарастания глубины инвазии в стенку органа. Таким изменениям подвергалась экспрессия показателя пролиферативной активности Кi67, показателя кишечного органогенеза CDX2, кишечного муцина MUC2, показателя дифференцировки и ростсупрессивных эффектов трансформированных клеток AKR1B10, а также циклофилина А. Не претерпевали подобной трансформации показатели апоптоза р53 и bcl2 и желудочный муцин MUC5. Природа данного феномена нуждается в дальнейшем изучении.

2.3 Валидация прогностической значимости тестирования белка AKR1B10 в опухолях желудка кишечного типа на независимой выборке Ранее (см. отчет за этап №4) на выборке из 46 больных РЖ (средний возраст больных 62,1±7,3 лет) при изучении операционного материала нами было показано, что у пациентов с кишечным типом рака желудка стадии T1при отсутствии гематогенного метастазирования процент клеток, 4N0-3M0, экспрессирующих AKR1B10, убывает по мере увеличения глубины прорастания опухоли. В случаях же с гематогенной диссеминацией подобного различий не обнаруживалось (таблица 3). Такой закономерности для диффузного гистотипа РЖ выявлено не было.

Таблица 3– Процент экспрессии AKR1B10 в железистоподобных структурах опухоли при различной глубине инвазии их в стенке желудка в зависимости от гематогенного метастазирования у больных кишечным типом рака Гематогенные Процент экспрессии протеина AKR1B разделяющей случаи с наличием или отсутствием метастазов кишечного типа рака желудка, было избрано значение «-0,25» (табл. 1). При этом условии в случаях, когда следовало ожидать возникновение гематогенного метастазирования, коэффициент регрессии должен был быть равен или больше, чем «-0,25». О низкой вероятности развития гематогенных метастазов должно было свидетельствовать значение коэффициента регрессии меньше «-0,25».

Для подтверждения указанной выше закономерности мы предприняли исследование уровня экспрессии белка AKR1B10 на дополнительной (независимой) прослежены результаты лечения в период глубиной от 1 до 6 лет, в сопоставлении с отдаленными метастазами. Морфологической оценке подвергалась ткань первичной опухоли, полученная при оперативном вмешательстве. Экспрессию белка в клетках опухоли оценивали с использованием иммуногистохимического анализа. Все методические условия и реагенты были стандартизованы и не отличались от таковых, примененных в предыдущем исследовании. Иммуногистохимическое исследование проводилось по стандартной методике. Для расправления срезов стекла со срезами помещались в термостат при 56С на 30 минут.

Использовался буфер для демаскировки комнатной температуры.

демаскировки по 200 мл буфера в каждом.

готовились в день исследования. Далее, проводилась депарафинизация срезов - стекла со срезами перемещались в ксилол (при температуре 39С) – порции по 10 минут. Затем, стекла со срезами проводились по спиртам (96) – 3 порции по 5 минут, далее помещались в дистиллированную воду на минут. Микроволновая печь прогревалась (устанавливался контейнер с дистиллированной водой (200 мл) внутрь печи и нагревался 5 минут при 60% мощности печи). Выходная мощность микроволновой печи составляла Вт. Стекла помещались в держатели для стекол и перемещались в контейнеры для демаскировки. В контейнере находился цитратный буфер (рН =6,0), который служил буфером для демаскировки антигенов.

Контейнеры ставили внутрь микроволновой печи в центр, на расстоянии 2 см друг от друга. Включали микроволновую печь на 5 мин при 60% от полной мощности печи. Далее, оставляли печь на 1 минуту с открытой дверцей, затем, продолжали нагрев при 30% от полной мощности печи еще 14 минут.

Контейнеры оставляли остывать 30 минут. Стекла из контейнеров для промывочном фосфатном буфере, промывали в 2 порциях по 5 минут. Срезы обводили гидрофобным карандашом и наносили реагент блокирующий эндогенную пероксидазную активность (Peroxidase blocking reagent производитель фирма “Dako”) на 5 минут. Стекла со срезами помещали в дистиллированную воду в 1 порцию на 5 минут, затем промывали в фосфатном буфере в 1 порции в течение 5 минут. Первичные/специфичные антитела наносили на 15 минут, при температуре 25С. Стекла со срезами промывали в промывочном фосфатном буфере в 2 порциях по 5 минут.

Наносилась визуализирующая система. Использовалась полимерная система визуализации производства фирмы “BioGenex” состоящая из усилителя сигнала (Super Enhancer), наносящегося первым компонентом системы на промывочном фосфатном буфере в 2 порциях по 5 минут. Затем, наносился второй компонент системы визуализации полимер (S-S Polymer) на 30 минут при температуре 25С. Стекла со срезами промывались в промывочном фосфатном буфере в 2 порциях по 5 минут. Далее, наносился раствор ДАБа (диаминобензидина). Использовался жидкий ДАБ производства фирмы “Dako”, который готовился перед применением. К 1 мл ДАБ-буфера добавлялась 1 капля ДАБ-хромогена (ДАБ-буфер и ДАБ-хромоген входят в состав набора “Dako”), смесь наносилась на 5 минут при контроле появления окраски (хода реакции) под микроскопом. Стекла со срезами промывались в гематоксилином в течение 6 секунд. Стекла с окрашенными срезами помещались в водопроводную воду на 10 минут. Стекла со срезами проводились по спиртам (96) в 3 порциях по 5 минут. Затем по толуолу в порциях по 5 минут. Далее срезы заключались в канадский бальзам. Стекла маркировались согласно протоколу.

высокоаффинные моноклональные антитела, полученные в институте молекулярной биологии им. В.А.Энгельгардта РАН (НОУ-ХАУ, Протокол № 02.445.11.7354-4 от 25 марта 2008 г.). Чувствительность антител в дот-блоте составила 100 пкг, в Вестерн-блоте – 100 пкг. Использовалось рабочее разведение антител 1:300.

Экспрессия AKR1B10 оценивалась по процентному содержанию паренхиматозного компонента первичной опухоли на различной глубине инвазии. Определялось количество клеток с позитивной экспрессией изучаемого маркера на 100 клеток в 10 полях зрения при увеличении х400).

Обработка полученных данных выполнялась с использованием пакета программ «Statistica 6.0». Применялся дисперсионный, корреляционный анализ по Спирмену, критерий 2, метод логистической регрессии.

Обсуждаются результаты с достоверностью различий при р 0,05 и с тенденцией различий при р 0,1.

Для подтверждения обнаруженной нами закономерности было проведено дополнительное исследование экспрессии AKR1B10 на новой выборке из 21 больного с кишечным типом рака желудка стадии T1-3N0-3M0, средний возраст 59,7±8,6 лет. Мужчин 13 (62%), женщин 8 (38%).

Исследование особенностей экспрессии AKR1B10 в зависимости от вероятности развития отдаленных метастазов на новой выборке позволило показать те же закономерности, что и в предыдущем исследовании (таблица 4).

Таблица 4 – Процент экспрессии AKR1B10 в железистоподобных структурах опухоли при различной глубине инвазии их в стенке желудка в зависимости от гематогенного метастазирования у больных кишечным типом рака желудка Гематогенные Процент экспрессии AKR1B10 в Также, как и в предыдущем исследовании, в случаях с развитием гематогенной диссеминации процент экспрессии AKR1B10 не изменялся при нарастании глубины инвазии опухолью стенки желудка, в случаях же с отсутствием прогрессирования процент экспрессии маркера снижался по мере погружения новообразования в толщу стенки органа.

В более ранних исследованиях нами представлены данные (Отчет за этап НИР) о том, что при интестинальном типе рака желудка экспрессия белка AKR1B10 в опухолевых клетках более дифференцированных железистоподобных и криброзных структур снижается по мере инвазии опухоли в стенку желудка. Уровень экспрессии белка AKR1B10 не связан с лимфогенным метастазированием как при интестинальном, так и при диффузном типе рака желудка. В отличие от интестинальных опухолей, при диффузном типе рака желудка нет заметной связи между уровнем экспрессии белка AKR1B10 с одной стороны и глубиной инвазии, лимфогенным метастазированием и летальностью - с другой. Полученные нами результаты указывают на вовлечение AKR1B10 в патогенез РЖ и делают актуальными исследования по определению сигнальных путей его участия в канцерогенезе, которые могут привести к идентификации потенциальных мишеней для терапии опухолей. Существенные различия в характере и интенсивности белковой экспрессии AKR1B10 в клетках диффузных и интестинальных опухолей указывают на разные механизмы его вовлечения в патогенез РЖ разных гистологических типов.

3 Мониторинг больных РЖ после лечения, сбор биопсийного материала и крови 3.1 Характеристика больных с различными гистологическими типами рака желудка, обследованных на протяжении 5 этапа клинического материала, а именно, сбор образцов биопсийного и операционного материала, крови больных с заполнением компьютерного регистра клинико-морфологическими данными. На базе клиники НИИ онкологии СО РАМН собраны дополнительно к имеющемуся банку биологических образцов парные образцы опухолей и нормальных тканей, полученных при хирургическом вмешательстве, от 15 пациентов с диффузным и интестинальным типами первично-диагностированного рака желудка. Все образцы тканей снабжены полной клинической документацией и охарактеризованы гистологически, диагноз заболевания к настоящему времени подтвержден.

замороженные образцы опухолей и нормальной слизистой желудка, образцы пополняется. Дополнена коллекция образцов опухолей в парафиновых блоках от больных раком желудка (96 человек), для которых есть сведения об отдаленных результатах лечения с глубиной наблюдения от года до 10 лет.

Образцы замороженных опухолей и нормальных тканей будут использованы для проведения гель-электрофореза, обратно-транскриптазной ПЦР и Вестерн-блот анализа с целью идентификации потенциальных маркеров и подтверждения высокого уровня их синтеза в опухолях желудка.

Образцы ткани в парафиновых блоках будут использованы для проведения иммуногистохимического анализа с целью подтверждения детекции идентифицированных в работе белков в опухолях желудка in situ, диагностической и прогностической значимости на основе сопоставления результатов детекции у больных с разным характером клинического течения заболевания и разными отдаленными результатами.

растворимых протеомных маркеров, выявления различий детекции в зависимости от гистотипа опухоли и отдаленных результатов лечения, что позволит оценить прогностическую значимость маркеров.

Описание клинического материала, собранного в процессе 5-го этапа, приведено в Таблице 5.

Таблица 5 – Клинико-морфологическая характеристика больных раком желудка Номер Возраст Пол Локализация Т Гистотип Гистологическое заключение Число Предполагается постоянное пополнение регистра, во-первых, за счет взятия новых образцов клинического материала от поступающих на лечение в НИИ онкологии больных раком желудка, во-вторых, в связи с проведением динамического периодического наблюдения (мониторинга) за состоянием больных, получивших специальное противоопухолевое лечение. В процессе динамического наблюдения осуществляются клинико-инструментальные методы обследования больных для выявления рецидивов или отдаленных метастазов. Осуществляется забор крови на этапах наблюдения. Создание регистра и банка различного типа образцов биологического материала дает возможность адекватного выбора образцов для исследований в соответствии с решаемыми задачами.

3.2 Результаты мониторинга больных раком желудка Мониторинг больных, перенесших операцию по поводу рака желудка, своевременного выявления рецидивов и метастазов. В исследование были включены 41 пациент с диагнозом РЖ, которые находились на разных этапах реабилитации после специального противоопухолевого лечения (хирургическая, цитостатическая и/или лучевая терапия) лечения. Период наблюдения составил от 3-х лет до одного года, начиная с 2008 года (таблица 6).

Таблица 6– Мониторинг больных РЖ Во время посещения лечащего врача НИИ онкологии у больного, пришедшего на мониторинг, осуществляется забор крови. В результате мониторинга эффективности лечения установлено, что на начало 2012 года из 41 больных РЖ: 27 человек без прогрессирования опухолевого процесса, у 6 человек отмечается прогрессирование заболевания (1 из них жив, 5 – умерли), 1 пациент умер в раннем послеоперационном периоде. Данные мониторинга пациентов после проведенного специфического лечения фактически дают возможность оценить следующие параметры: время до появления рецидива или диссеминации злокачественного процесса, выживаемости. Все эти параметры необходимы для оценки прогностической значимости выявленных в исследовании потенциальных белковых маркеров.

3.3 Результаты тестирования инфицированности больных раком желудка H.pylori Инфекция Н.pylori широко распространена во всем мире, около 60% населения земного шара инфицированы этим микроорганизмом [34].

D.Y.Graham назвал H.pylori наиболее часто встречающейся инфекцией, наряду с Streptococcus mutans, вызывающим кариес [35]. Она является основной причиной хронического гастрита. H.pylori определяется у 95% больных с язвенной болезнью двенадцатиперстной кишки, у 70-80% с язвенной болезнью желудка, у 50% больных с неязвенной диспепсией.

Инфицированность H.pylori в четыре раза повышает риск развития язвенной болезни [36]. Ретроспективные исследования показали взаимосвязь инфекции H.pylori и рака желудка, в том числе включая лимфому желудка [37]. Риск развития рака желудка, ассоциированного с H.pylori, достигает 70% в индустриальных районах и 80% в сельской местности [38, 39].

заболеваний зависит от факторов, относящихся к самому микроорганизму, организму хозяина и окружающей среде. Бактериальные факторы, обеспечивающие колонизацию слизистой оболочки желудка (СОЖ) H.pylori, включают уреазу, жгутики, адгезины, альфа-глутамилтранспептидазу.

Липополисахариды, уреаза и вакуолизирующий цитотоксин являются факторами, обеспечивающими возможность H.pylori персистировать в организме хозяина в течение десятилетий и вызывать интенсивный воспалительный ответ, ведущий к повреждению клеток хозяина.

Патогенез H.pylori - инфекции у людей может быть представлен в виде трех этапов [40].

1) поступление в просвет желудка, прикрепление к эпителию, колонизация СОЖ;

2) ускользание от иммунного ответа, нарушение или использование иммунной системы организма хозяина;

3) размножение, повреждение ткани, передача новому хозяину или распространение на соседние органы.

Фактор вирулентности определяется своим участием в одном или нескольких из этих процессов [40, 41]. В настоящее время идентифицирован ряд факторов вирулентности H.pylori, включая бактериальные гены cagA, vacA, iceA. Однако, с другой стороны, накоплены убедительные данные о том, что ни один из этих факторов не имеет специфической связи с развитием определенного заболевания. Общепризнанно, что воспалительный ответ в СОЖ является ключом к пониманию механизмов, ведущих к развитию тяжелых заболеваний, ассоциированных с Н.pylori-инфекцией.

Любой фактор, приводящий к усилению воспалительного ответа в СОЖ, может усиливать риск тяжелых последствий инфицирования.

Гены H.pylori в составе так называемого "островка патогенности" cag (cagA pathogenicity island, cag PAI) причастны к развитию воспалительного ответа путем инициации каскада сигнальных трансдукций, приводящего к продукции интерлейкина (ИЛ)-8. Ответная выработка провоспалительных цитокинов и клеточный (Th-1 - опосредованный) ответ приводят к дальнейшему прогрессированию воспалительной реакции. Активность ферментов NO-синтетазы (iNOS) и циклооксигеназы может нарушать баланс между процессами апоптоза желудочных эпителиоцитов и их пролиферацией, способствуя в первом случае изъязвлению СОЖ, а во втором - развитию опухолей. [42].

Мы в своем исследовании провели оценку инфицированности Helicobacter pylori 35 больных раком желудка. Для определения уровня антител к Helicobacter pylori в сыворотке использовали набор реагентов для иммуноферментного выявления суммарных антител к антигену CagA Helicobacter pylori производства ЗАО «Вектор-Бест» (Новосибирск) (тест – система «ХеликоБест - антитела»).

Результаты ИФА регистрировали с помощью микропланшетного фотометра "Multisan FC" (Thermo Fisher Scientific, Финляндия) в двухволновом режиме:

основной фильтр – 450 нм, референс фильтр – 620 нм. Для оценки исследуемых образцов сыворотки руководствовались рекомендациями, приведенными в инструкции по использованию тест – системы.

Из 35 образцов сыворотки, полученных от больных раком желудка, образец был оценен как положительный, т.е. содержащий антитела к антигену CagA Helicobacter pylori, а 14 образцов оценены как отрицательные.

Таким образом, инфицированность Helicobacter pylori в исследуемой нами группе больных раком желудка составила 60 % (рисунок 8), что вполне согласуется с литературными данными [37,38].

Рисунок 8 – Результаты тестирования сывороток больных раком желудка на наличие антител к антигену CagA Helicobacter pylori Мы оценили частоту инфицирования Н.pylori в группах больных РЖ с диффузным и кишечным типом опухоли (таблица 7).

Таблица 7 – Частота инфицирования Helicobacter pylori больных с разными гистологическими типами рака желудка Для проверки гипотезы о значимости различий между исследуемыми группами использовали критерий 2 с поправкой Йетса, высчитываемый в двухпольных таблицах. Различия между группами считалось статистически значимым при p0,05. При оценке зависимости гистологического типа РЖ от инфицированности больных H. pylori, статистически значимых различий между диффузным и интестинальным гистологическим типом выявлено не было (p=0,36).

В сравнительном аспекте, исследование на наличие антител к H. pylori в сыворотке здоровых лиц (контроль) показало, что инфицированными оказались 18 человек, сомнительный результат был получен в 12 случаях и у 15 человек отсутствовали антитела к H. pylori (рисунок 9).

Рисунок 9 – Распределение условно здоровых лиц по результатам анализа на При этом инфицирование H.pylori наблюдалось как в группе людей со здоровой слизистой оболочкой желудка, так и у людей с явлениями гастрита.

данными о том, что этой инфекцией заражена почти половина человечества [43]. При этом, с одной стороны H. pylori можно рассматривать с определенными оговорками, как часть нормальной бактериальной флоры желудочно-кишечного тракта, которую не всегда нужно элиминировать со слизистой оболочки желудка. С другой стороны, почти у 50% лиц, инфицированных Helicobacter pylori, разовьётся атрофический гастрит, который в 90% случаев является причиной развития язвенной болезни и в большинстве случаев приводит к раку желудка. Эрадикация инфекции Helicobacter pylori Соответственно, уменьшается или полностью исчезает риск развития заболеваний, связанных с атрофическим гастритом [ 44, 45].

Таким образом, проведенное нами исследование показало наличие инфицированности H.pylori у 60% больных раком желудка. При этом различий по частоте между больными с разными гистотипами не отмечено.

Полученные данные в дальнейшем могут быть использованы при анализе взаимосвязи уровня экспрессии изучаемых белков с патогенетическизначимыми признаками злокачественного процесса (клиникоморфологическими параметрами). Поскольку наличие H.pylori может влиять ассоциированного с этой бактерией воспалительного ответа, необходим учет инфицированности у больных РЖ для корректного суждения о возможных механизмах их участия в опухолевой прогрессии.

4 Проведение дополнительных исследований по тестированию экспрессии генов ряда белков ОТ-ПЦР в реальном времени в тканях РЖ, других опухолях и нормальных тканях Ранее в процессе выполнения экспериментальных работ нами было показано значимое изменение уровня экспрессии генов INHBA, CTGF, PMEPA1, FGF12 и AKR1B10 в опухолевой ткани по сравнению с нормальной. Для подтверждения полученных результатов уровень экспрессии указанных генов был оценен на дополнительной выборке больных РЖ (13 человек). Для проведения оценки относительного уровня экспрессии данных генов в опухолевой и нормальной ткани желудка, данная группа больных была объединена с уже исследованной выборкой.

Критерии включения:

-Диффузный и интестинальный гистологический тип рака желудка;

-Письменное информированное согласие на участие в исследовании;

-Морфологически подтвержденный диагноз, независимо от стадии;

-Возраст от 18 до 75 лет;

Критерии исключения:

-Рак кардиального отдела желудка -Отказ пациентов от терапии;

-Смешанный гистологический тип опухоли.

Материалы и методы исследования. Материалом для исследования послужили операционный материал рака желудка (РЖ) и образцы нормальной ткани желудка, взятые во время проведения операции. Работа проведена с соблюдением принципов добровольности и конфиденциальности в соответствии с «Основами законодательства РФ об охране здоровья граждан» (Указ Президента РФ от 24.12.1993 № 2288), получено разрешение локального этического комитета института и информированное согласие всех обследованных.

Исследуемая группа из 55 больных была разделена по основным клинико-морфологическим характеристикам опухоли: глубина инвазии (T), лимфогенное метастазирование (N), гистологический тип опухоли. Для проведения статистического анализа часть этих подгрупп была организована в классы: Т1-2 и Т3-4, N0 и N1-3 а также, по признаку гистологического типа – в классы больных с диффузным и кишечным гистологическим типом опухоли.

Пациенты со смешанным типом опухоли в исследование не были включены.

Характеристика больных представлена в таблице 8.

замороженных образцов опухоли желудка и нормального эпителия желудка тех же пациентов.

Таблица 8 – Клинико-патологическая характеристика больных РЖ Регионарное 1 классификация TNM 2 T – первичная опухоль 3 N – лимфогенное метастазирование 4 M – гематогенное метастазирование Выделение РНК. Во время оперативного вмешательства нормальная ткань забиралась в нескольких сантиметрах от опухолевой и подвергалась морфологическому исследованию для подтверждения отсутствия опухолевых клеток. После резекции опухоли образцы опухолевой и нормальной слизистой максимально быстро помещались в жидкий азот и далее хранились при -80°С. Собранные образцы тканей гомогенизировали с помощью шаровой мельницы Sartorius Mikro Dismembrator U (Eppendorf) при 7200 об/мин в течение 60 сек и охлаждении жидким азотом. Суммарную РНК из опухоли выделяли с помощью набора RNeasy mini Kit (Qiagen, Inc).

Качество выделенной РНК оценивали электрофоретически по наличию выраженных бендов 28S и 18S рибосомальной РНК (рисунок 10).

Концентрацию и чистоту РНК оценивали на спектрофотометре NanoDropTermo Scientific, USA), пример количественной оценки представлен на рисунке 11 (данный образец был выделен с помощь набора RNeasy mini Kit (Qiagen, Inc). На рисунке видны концентрации РНК от 20-52 нг/мкл и чистота А280/А260 нм = 2,00-2,05 А260/А230 нм = 1,90-2,3.

Рисунок 10 – Электрофореграмма тотальной РНК, выделенной RNeasy mini Kit (Qiagen, Inc) из опухоли желудка (1). Маркер молекулярной массы (2) 100bp. Видны бенды: 28 S и 18 S рибосомальной РНК, 28S/18S Рисунок 11 – Концентрация РНК в образцах, выделенных из опухоли больных до лечения 20-52 нг/мкл, соотношения А260/А280= 2,00-2, Оценка экспрессии генов. Экспрессию исследуемых генов оценивали с помощью метода обратной транскрипции и ПЦР в режиме реального времени. Для получения кДНК на матрице РНК проводили реакцию обратной транскрипции с помощью набора RevertAidtm (K1622) (Ферментас, Литва). Далее с полученной кДНК проводилась ПЦР в режиме реального времени. Реакционная смесь на 1 пробу (общий объём 15 мкл) содержит: 1, мкл буфера для Taq-полимеразы 10-ти кратного (160 mM (NH4)2SO4, 670 mM полимеразой)), 1,5 мкл кДНК, 0,75 мкл 50mM MgCl2, 1,5 мкл 2,5 mM dNTP (Сибэнзим, Россия), 0,1 мкл Taq ДНК-полимеразы E338 (Сибэнзим, Россия), по 1мкл каждого из праймеров с концентрацией 10 пмоль/мкл, 1мкл зонда с концентрацией 10пмоль/мкл и вода milliQ до 15 мкл. Сверху наслаивалось для предотвращения испарения 15мкл минерального масла Ultra Pure Grade (Медиген, Россия). Для проведения ПЦР применяли пробирки на 0,2 мл (Axygen, USA). Готовили пробирки с праймерами и зондом, в которые добавляли реакционную смесь (из общего пула) вместе с матрицей.

Реакционную смесь раскапывали по 12 мкл в пробирки. 2х-шаговая программа на амплификаторе состоит из следующих этапов: 1 цикл – 94оС в течении 2х минут для предварительной денатурации; 42 цикла – 94оС в течении 12 сек и 61оС в течении 25 сек с оценкой интенсивности флуоресценции на длине красителя Относительный уровень экспрессии (по отношению к гену рефери ACTB) оценивался по методу Сt с помощью программы Rotor-Gene 6000 Series Software 1.8 (Build 11), ISO 9001:2000 (Reg № QEC21313) (рисунок 12).

Рисунок 12 – Окно программы Rotor-Gene 6000 Series Software 1.8(Build 11) с отображением кривых флуоресценции исследуемых генов Последовательность праймеров и зондов (FAM) подбирали при помощи программы Oligo Analysis Vector NTI 9.0 с использованием генетического банка данных www.ncbi.nlm.nih.gov. Использовали следующие праймеры и зонды оригинального дизайна:

Forward Primer 5’-TGTTCCAGAGCATGGAGATCA-3’ Reverse Primer 5’-GTGCAGACAGCTTGTAGTGG-3’ FAM 5’-CATCGTGGTGGTGATGATGGTGATG-3’BHQ Forward primer 5’-GCAGGCTAGAGAAGCAGAGC -3’ Reverse primer 5’-ATGTCTTCATGCTGGTGCAG -3’ FAM 5’-TGCGAAGCTGACCTGGAAGAGAACA -3’BHQ Forward Primer 5’-CGAAAACAGCGACTACACTCT-3’ Reverse Primer 5’-TAGCCTTCACTCCTTGGATGG-3’ FAM 5'-CCGTGGGCCTGCGTGTAGT-3’BHQ Forward Primer 5’- AATGAATGAACTTATGGAGCAGA -3’ Reverse Primer 5’- GGTCACTGCCTTCCTTGG -3’ FAM 5'- TCATCACGTTTGCCGAGTCAGGA -3’BHQ Forward Primer 5’- CAAAGCCAAGATGCCCATT -3’ Reverse Primer 5’- ACCTTCACTGCTTCTTTCACTTT -3’ FAM 5'- CCTGGGCACTTGGAAGTCTCCT -3’BHQ Forward primer 5’- AGCACAGAGCCTCGCCTTT -3’ Reverse primer 5’- AGCCGTTGTCGACGACGA -3’ FAM 5’- ACCCGCCGCCAGCTCACCAT -3’BHQ Статистическую обработку материала проводили с помощью пакета программ “STATISTICA 6.0”. Сравнение среднего уровня экспрессии генов проводили с помощью непараметрического критерия Уилкоксона-МаннаУитни.

На индивидуальном уровне дифференциальная экспрессия оценивалась посредством выявления доли больных с более чем двукратным изменением показателя относительной экспрессии исследуемых генов в опухоли по сравнению с нормальной слизистой. В случаях менее чем двукратного повышения, либо понижения данного показателя в опухоли, экспрессия считалась не претерпевшей изменений.

Результаты и обсуждение. В ходе проделанной работы был определен уровень экспрессии генов PMEPA1, CTGF, INHBA, AKR1B10 и FGF12 в опухоли желудка и парном нормальном желудочном эпителии 55 больных РЖ. В результате сравнения уровня экспрессии указанных генов в опухолевой и нормальной ткани желудка относительно гена-рефери ACTB в общей группе больных повышенная экспрессия относительно нормальной ткани установлена для генов PMEPA1 (0,0263 (0,0182;0,0384) в опухоли по сравнению с 0,0132 (0,0079;0,0281) в нормальной ткани, Me (Q25-75) и INHBA (0,0117(0,0072;0,0198) и 0,0012(0;0,0073) соответственно) (p0,001) (таблица 9). Относительный уровень экспрессии данных генов более чем в раза повышался у 41,7% и 66,0% больных соответственно (таблица 10).

Кроме того, в опухолевой ткани, вне зависимости от стадии процесса и гистологического типа опухоли, наблюдалось значимое понижение уровня 0,2525(0,1203;0,5075), двукратное понижение у 63% больных. При сравнении уровней экспрессии генов CTGF и FGF12 в опухолевой и нормальной ткани желудка в общей группе значимых различий показано не было (p0,05).

Таблица 9 – Относительный уровень экспрессии генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 в опухолевой и нормальной ткани желудка в общей группе больных РЖ (Me (Q25-75)) PMEPA (0,0182;0,0384) (0,0079;0,0281) (0,0434;0,1095) (0,0358;0,1385) (0,0007;0,0023) (0,0006;0,0026) INHBA AKR1B (0,0474;0,2169) (0,1203;0,5075) Таблица 10 – Дифференциальная экспрессия генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 на индивидуальном уровне в общей группе больных РЖ Гены Увеличение Уменьшение экспрессия PMEPA1 20(41,67%) 6(12,5%) 22(45,83%) CTGF 14(29,17%) 14(29,17%) 20(41,67%) FGF12 19(39,58%) 16(33,33%) 13(27,08%) AKR1B10 8(16,33%) 31(63,27%) 10(20,41%) Продукт гена INHBA функционирует в клетке в форме гомо- или гетеродимеров. Ингибин бета А образует гомодимер, называемый активин А, или гетеродимер с ингибином бета В, активин АВ [46] и обладает весьма широким спектром действия, во множестве тканей выполняет функцию ростового фактора и фактора дифференцировки, и весьма важен в эмбриональном развитии организма. Активин А in vitro проявляет свойства опухолевого супрессора, индуцируя апоптоз и ингибируя деятельность теломеразы у клеток рака желудка SNU-16 [47]. Однако при клинических исследованиях гиперэкспрессию этого гена в клетках опухоли на ранних стадиях связывают с неблагоприятным прогнозом течения заболевания [48].

Ген AKR1B10 кодирует один из членов суперсемейства альдо/кето редуктаз (Cao, D., 1988., Hyndman, D. J., 1988). AKR1B10 участвует в утилизации алифатических и ароматических альдегидов и метаболизме ретиноевой кислоты [49]. Понижение уровня экспрессии этого гена индуцирует пролиферацию клеток, их дифференцировку, и, по некоторым данным, апоптоз [50, 51]. Гиперэкспрессия AKR1B10 ассоциирована с курением [52] и наблюдается при раке лёгкого, в остальных же случаях, в том числе при РЖ, она обычно понижается [50, 53, 54].

При разделении группы больных по основным клиникопатологическим параметрам результаты анализа уровня экспрессии гена INHBA не изменялись. Повышение уровня экспрессии гена PMEPA наблюдалось у больных с интестинальным гистологическим типом опухоли, в группе с наличием метастазов в регионарные лимфоузлы и у больных с малой глубиной инвазии (T1-T2). В группе больных T3-T4 эти различия сохранялись на уровне тенденции (p=0,053) (таблица 11, 12, 13,14,15).

Продуктом гена PMEPA1 является трансмембранный белок, играющий значительную роль во множестве сигнальных путей. [55]. Прослеживается явная взаимосвязь работы гена PMEPA1 и ростового фактора TGF при РМЖ, раке желудочно-кишечного тракта и др., при которых его экспрессия повышается [56, 57, 58, 59]. Выявленная связь между уровнем экспрессии гена PMEPA1 и гистологическим типом опухоли (его экспрессия повышена при интестинальном типе РЖ, но не при диффузном), может являться следствием различий в молекулярно генетических предпосылках их возникновения.

Далее нами был проведен анализ уровней экспрессии генов PMEPA1, CTGF, INHBA, AKR1B10 и FGF12 в группах больных с интестинальным и диффузным гистологическим типом опухоли. Было выявлено значимое повышение экспрессии генов CTGF и FGF12 у больных с диффузным типом опухоли по сравнению с опухолями интестинального гистологического типа (0,0932 (0,0601;0,1688) против 0,0491 (0,0289;0,0707) и 0,0016 (0,0011;0,0024) и 0,0009(0,0004;0,002) соответственно, таблица 11, 12, 13).

Таблица 11 – Относительный уровень экспрессии генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 в опухолевой и нормальной ткани желудка в группе больных с диффузным гистологическим типом опухоли (Me (Q25-75)) (0,0164;0,0348) (0,0102;0,0337) CTGF (0,0601;0,1688) (0,0379;0,1664) (0,0078)* FGF (0,0011;0,0024) (0,0006;0,0032) (0,0288)* INHBA AKR1B (0,0521;0,2186) (0,1237;0,6524) 0, Примечания - знаком * отмечены уровни значимости различий между группами Диффузный и Интестинальный (см.таблицу 6) Таблица 12 – Относительный уровень экспрессии генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 в опухолевой и нормальной ткани желудка в группе больных с интестинальным гистологическим типом опухоли (Me (Q25-75)) PMEPA (0,0193;0,0583) (0,0064;0,0151) CTGF (0,0289;0,0707) (0,0296;0,0862) 0, (0,0004;0,002) (0,0006;0,0019) INHBA AKR1B (0,043;0,1389) (0,1203;0,3727) Таблица 13 – Дифференциальная экспрессия генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 на индивидуальном уровне в группах больных с диффузным и интестинальным гистологическим типом опухоли Гены Увеличение Уменьшение экспрессия Увеличение Уменьшение экспрессия PMEPA1 6(25%) 4(16,67%) 14(58,33%) 15(62,5%) 1(4,17%) 8(33,33%) CTGF 7(29,17%) 7(29,17%) 10(41,67%) 6(25%) 8(33,33%) 10(41,67%) FGF12 10(41,67%) 7(29,17%) 7(29,17%) 8(33,33%) 10(41,67%) 6(25%) INHBA 17(65,38%) 5(19,23%) 4(15,38%) 17(70,83%) 1(4,17%) 6(25%) AKR1B10 4(16,67%) 17(70,83%) 3(12,5%) 4(16%) 14(56%) 7(28%) Таблица 14 – Относительный уровень экспрессии генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 в опухолевой и нормальной ткани желудка в группе больных с отсутствием метастазов в регионарные лимфоузлы (Me (Q25-75)) PMEPA (0,018;0,0313) (0,0081;0,0343) 0, CTGF (0,0269;0,0932) (0,0601;0,1524) 0, (0,0006;0,0021) (0,0006;0,004) INHBA AKR1B (0,0465;0,2321) (0,2094;0,8351) Таблица 15 – Относительный уровень экспрессии генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 в опухолевой и нормальной ткани желудка в группе больных с наличием метастазов в регионарные лимфоузлы (Me (Q25-75)) PMEPA (0,0191;0,0585) (0,0076;0,0207) (0,0008;0,0024) (0,0005;0,0015) INHBA AKR1B Таблица 16 – Дифференциальная экспрессия генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 на индивидуальном уровне в группах больных с наличием и отсутствием метастазов в регионарные лимфоузлы PMEPA1 8(38,1%) 3(14,29%) 10(47,62%) 13(48,15%) 2(7,41%) 12(44,44%) CTGF 4(19,05%) 11(52,38%) 6(28,57%) 9(33,33%) 4(14,81%) 14(51,85%) FGF12 4(19,05%) 11(52,38%) 6(28,57%) 14(51,85%) 6(22,22%) 7(25,93%) AKR1B10 2(10%) 15(75%) 3(15%) 6(20,69%) 16(55,17%) 7(24,14%) Таблица 17 – Относительный уровень экспрессии генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 в опухолевой и нормальной ткани желудка в группе больных T1-T2 (Me (Q25-75)) PMEPA (0,0195;0,0408) (0,0081;0,0207) (0,0316;0,0932) (0,0341;0,1091) (0,0007;0,0024) (0,0006;0,0019) INHBA (0,0502;0,1342) (0,0002;0,0048) AKR1B (0,0502;0,1342) (0,0854;0,2536) Таблица 18 – Относительный уровень экспрессии генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 в опухолевой и нормальной ткани желудка в группе больных T3-T4 (Me (Q25-75)) (0,0167;0,0353) (0,0078;0,0384) (0,0451;0,1492) (0,0394;0,1803) (0,0007;0,0022) (0,0006;0,004) INHBA AKR1B (0,0418;0,2351) (0,1663;0,5562) Таблица 19 – Дифференциальная экспрессия генов PMEPA1, CTGF, FG12, INHBA и AKR1B10 на индивидуальном уровне в группах больных с малой и большой глубиной инвазии первичной опухоли PMEPA1 10(47,62%) 1(4,76%) 10(47,62%) 11(40,74%) 4(14,81%) 12(44,44%) CTGF 8(38,1%) 6(28,57%) 7(33,33%) 5(18,52%) 9(33,33%) 13(48,15%) FGF12 12(57,14%) 8(38,1%) 1(4,76%) 6(22,22%) 9(33,33%) 12(44,44%) INHBA 14(77,78%) 2(11,11%) 2(11,11%) 20(62,5%) 4(12,5%) 8(25%) AKR1B10 4(23,53%) 9(52,94%) 4(23,53%) 4(12,5%) 22(68,75%) 6(18,75%) Члены семейства факторов роста фибробластов (FGF) играют важную роль в процессах эмбрионального развития, вовлечены в регуляцию митоза, клеточной выживаемости, пролиферации, морфогенеза, тканевой регенерации [60]. Специфическая функция FGF12 еще не определена, а тот факт, что при трансфекции гена в клетки млекопитающих белок накапливается в ядре и не секретируется, указывает на его свойства как ядерного сигнального элемента. Есть косвенные данные о его возможном вовлечении в процессы неоангиогенеза [61], способности ингибировать апоптоз, что свидетельствует о потенциальной онкогенной роли FGF12 [62].

Ранее нами было показано повышение уровня экспрессии данного гена у больных с диффузным гистологическим типом опухоли по сравнению с нормальной тканью. При увеличении исследуемой выборки подтверждения указанных результатов не было получено. Впервые выявленное нами повышение уровня экспрессии гена FGF12 в опухолях диффузного типа по сравнению с интестинальным (таблица 11, 12) может говорить о перспективности его исследования в качестве дифференциального маркера данных гистологических типов.

Для гена CTGF также показан более высокий средний уровень мРНК в опухолях диффузного типа по сравнению с интестинальными. CTGF, открытый в 90-х годах, как ростовой фактор, секретируемый клетками эндотелия сосудов человека [63], регулирует пролиферацию, миграцию, выживаемость клеток, адгезию и ангиогенез [64]. Другими авторами [65] подтверждалось полученными нами ранее данными о повышении его экспрессии у больных с наличием регионарного метастазирования. Тем не менее, проведенное исследование на расширенной выборке не подтвердило данные результаты (таблица 14, 15).

Известно наличие функциональной взаимосвязи генов CTGF и TGF в эпителиально-мезенхимальным переходе (ЭМП). TGF, ключевой фактор ЭМП, регулирует экспрессию гена CTGF, в промоторном участке которого имеются элементы связывания TGF и сайт связывания Smad [1, 66]. Для CTGF показана способность ингибировать экспрессию E-кадхерина, что совпадает с основным механизмом TGF-зависимого ЭМП [1]. Принимая во внимание, что снижение экспрессии E-кадхерина является одним из молекулярных механизмов развития наследственного РЖ диффузного типа, можно предположить, что полученные нами данные о повышении экспрессии гена CTGF в опухолях данного гистологического типа отражают его роль в патогенезе РЖ.

В литературе содержится много сведений о роли CTGF в патогенезе различных злокачественных новообразований (РЖ, рака молочной железы, поджелудочной железы, рака яичников, глиобластомы и др.), как правило, экспрессия его в опухоли понижена. Тем не менее, для РЖ показано, что метастазированием и низкими показателями общей выживаемости, что отражает перспективность использования данного гена в качестве прогностического маркера [65]. Кроме того, по некоторым данным, повышенная экспрессия CTGF вносит вклад в формирование лекарственной устойчивости опухоли [67] В результате проведения анализа уровня экспрессии генов INHBA, AKR1B10, PMEPA1, CTGF и FGF12 в опухолевой и нормальной ткани желудка на увеличенной выборке больных РЖ, были подтверждены полученные ранее результаты о повышенном уровне экспрессии генов INHBA и PMEPA1 в группе больных без разделения по основным клинико-морфологическим характеристикам (таблица 15, 16, 17, 18, 19). Повышение уровня экспрессии гена INHBA, как и понижение экспрессии AKR1B10 характеризовалось высоким уровнем значимости и не зависело от стадии опухолевого процесса.

интестинального, но не диффузного гистологического типа и в группе с наличием метастазов в регионарные лимфоузлы. Повышение же его экспрессии в опухолях с большой глубиной инвазии не было подтверждено.

Подтвержден повышенный уровень экспрессии гена FGF12 в опухолях диффузного гистологического типа по сравнению с интестинальным.

дальнейших исследований генов INHBA, PMEPA1 и AKR1B10 в качестве молекулярных маркеров РЖ. Более высокий средний уровень мРНК гена PMEPA1 в опухолях интестинального типа по сравнению с диффузным, а также у больных с наличием метастазов в регионарные лимфоузлы говорит о возможности его использования при дифференциальной диагностике РЖ различных гистологических типов и в качестве прогностического маркера РЖ.

ЗАКЛЮЧЕНИЕ

государственному контракту № 02.740.11.0769 от «12» апреля 2010 г.

представлены результаты, полученные при выполнении пятого этапа специфичности.

В качестве белков, для которых планируется получение специфичных антител, выбраны растворимые белки AKR1B10 и INHBA, а также мембраносвязанный белок PMEPA1, для которых на предыдущих этапах НИР выявлена ассоциация с раком желудка. В отчете за этап 4 было описано клонирование нуклеотидных последовательностей, соответствующих выбранным фрагментам белков, в плазмидных векторах. На пятом этапе проведены работы по оптимизации условий гетерологичной экспрессии и очистке рекомбинантного белка AKR1B10 (фрагмент G214-Y316) в клетках E. coli. Подобраны условия для рефолдинга целевой биомолекулы из телец включений, с применением методов гель-фильтрации и КДспектрополяриметрии было установлено, что препарат белка гомогенен, а иммунизации кроликов для получения специфической сыворотки.

В качестве альтернативы, к традиционному получению антигенов путем экспрессии белков в гетерологичных системах, был применен комплексный подход к дизайну и синтезу пептидов-миметиков антигенных детерминант с учетом области локализации потенциальной детерминанты и отсутствия перекрестной реактивности выбранных пептидов с иными биомолекулами. Методами твердофазного пептидного синтеза получены пептиды-миметики антигенных детерминант белков PMEPA1 и INHBA, проведена конъюгация с белком-носителем (овальбумином) и иммунизация кроликов с целью получения специфической сыворотки. Иммуноферментный анализ активности полученных кроличьих поликлональных сывороток к коньюгатам (предварительно истощенных против белка-носителя) показал, что получен необходимый уровень иммунного ответа на пептиды-миметики.

Получены хроматографические сорбенты на основе NHS-сефарозы с ковалентно-пришитыми пептидами для выделения фракции, обогащенной анти-пептидными антителами. Выполнены эксперименты по очистке (в том числе и в полу-препаративном масштабе), подтвердившие высокую селективность данного метода. Примененный метод получения сорбентов на основе NHS-сефарозы для аффинной очистки специфических антипептидных антител из сыворотки иммунизированных животных обладает рядом преимуществ, по сравнению с традиционными подходами к их созданию. Путем подбора условий конъюгации была достигнута 98% эффективность связывания пептидов-миметиков с матрицей сорбента.

На срезах ткани рака желудка иммуногистохимическим анализом показано сродство иммунных сывороток к пептидам PMEPA1 и INHBA к продуктам в цитоплазме опухолевых клеток и в части элементов воспалительного инфильтрата.



Pages:   || 2 |


Похожие работы:

«1 Общие положения Полное наименование вуза на русском языке: федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Тихоокеанский государственный университет. Сокращенные наименования вуза на русском языке: Тихоокеанский государственный университет, ФГБОУ ВПО ТОГУ, ТОГУ. Полное наименование на английском языке: Pacific National University. Сокращенное наименование на английском языке: PNU. Место нахождения вуза: 680035, г. Хабаровск, ул....»

«ФЕДЕРАЛЬНОЕ АГЕНСТВО ПО ОБРАЗОВАНИЮ Государственное образовательное учреждение высшего профессионального образования Уральский государственный университет им. А.М.Горького ИОНЦ Бизнес-информатика Институт управления и предпринимательства Кафедра экономики, финансов и менеджмента Стратегический менеджмент Сборник задач и практических ситуаций Руководитель ИОНЦ __2007 Екатеринбург 2007 1 УТВЕРЖДАЮ Руководитель ИОНЦ (подпись) (дата) Составитель (разработчик) Попова Людмила Николаевна, к.э.н.,...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное агентство по образованию Государственное образовательное учреждение высшего профессионального образования Новосибирский государственный университет (НГУ) Кафедра общей информатики Е.Н. Семенова РЕАЛИЗАЦИЯ ТЕХНОЛОГИИ ЗАЩИЩЕННОГО ОБНОВЛЕНИЯ ПРОГРАММНЫХ СИСТЕМ ПО СЕТИ МАГИСТЕРСКАЯ ДИССЕРТАЦИЯ по направлению высшего профессионального образования 230100.68 ИНФОРМАТИКА И ВЫЧИСЛИТЕЛЬНАЯ ТЕХНИКА ФАКУЛЬТЕТ ИНФОРМАЦИОННЫХ ТЕХНОЛОГИЙ Тема...»

«RMC-M20 Уважаемый покупатель! Благодарим вас за то, что вы отдали предпочтение бытовой технике REDMOND. REDMOND — это качество, надежность и неизменно внимательное отношение к потребностям наших клиентов. Надеемся, что вам понравится продукция нашей компании, и вы также будете выбирать наши изделия в будущем. Мультиварка REDMOND RMC-M20 — современный многофункциональный прибор для приготовления пищи, в котором компактность, экономичность, простота и удобство использования гармонично сочетаются...»

«УДК 004.432 ББК 22.1 Х27 Хахаев И. А. Х27 Практикум по алгоритмизации и программированию на Python: / И. А. Хахаев М. : Альт Линукс, 2010. 126 с. : ил. (Библиотека ALT Linux). ISBN 978-5-905167-02-7 Учебно-методический комплекс Практикум по алгоритмизации и программированию на Python предназначен для начального знакомства с основными алгоритмами и с программированием на языке Python в интегрированных средах разработки (IDE) Geany и Eric. Комплекс состоит из учебного пособия, в котором...»

«ВЕСТНИК МОСКОВСКОГО ГОРОДСКОГО ПЕДАГОГИЧЕСКОГО УНИВЕРСИТЕТА НаучНый журНал СЕРИя ЕстЕствЕННыЕ Науки № 2 (12) Издается с 2008 года Выходит 2 раза в год Москва 2013 VESTNIK MOSCOW CITY TEACHERS TRAINING UNIVERSITY Scientific Journal natural ScienceS № 2 (12) Published since 2008 Appears Twice a Year Moscow 2013 Редакционный совет: Реморенко И.М. ректор ГБОУ ВПО МГПУ, председатель кандидат педагогических наук, доцент, почетный работник народного образования Рябов В.В. президент ГБОУ ВПО МГПУ,...»

«РАБОЧИЕ ПРОГРАММЫ для студентов 1-го курса ускоренного обучения специальности Социальная педагогика Самара 2006 ФЕДЕРАЛЬНОЕ АГЕНТСТВО ПО ОБРАЗОВАНИЮ ГОСУДАРСТВЕННОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ САМАРСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ Кафедра педагогики РАБОЧИЕ ПРОГРАММЫ ДЛЯ СТУДЕНТОВ 1-ГО КУРСА УСКОРЕННОГО ОБУЧЕНИЯ СПЕЦИАЛЬНОСТИ СОЦИАЛЬНАЯ ПЕДАГОГИКА Самара Издательство Самарский университет Печатается по решению Редакционно-издательского совета Самарского...»

«Государственный комитет по науке и технологиям Республики Беларусь ГУ Белорусский институт системного анализа и информационного обеспечения научно-технической сферы Молодежный инновационный форум ИНТРИ – 2010. Материалы секционных заседаний 29–30 ноября 2010 г. Минск 2010 УДК 001 (063)(042.3) ББК 72.4 М 34 Под общей редакцией д-ра техн. наук И. В. Войтова М 34 Материалы секционных заседаний. Молодежный инновационный форум ИНТРИ – 2010. — Минск: ГУ БелИСА, 2010. — с. ил., табл. с.: ISBN...»

«ВЕСТНИК ТОМСКОГО ГОСУДАРСТВЕННОГО УНИВЕРСИТЕТА 2008 Филология № 2(3) УДК 811.161.1 О.И. Блинова СЛОВАРЬ ФИТОНИМОВ СРЕДНЕГО ПРИОБЬЯ КАК ИСТОЧНИК ДИАЛЕКТНОЙ МОТИВОЛОГИИ* Статья посвящена источниковедческому исследованию возможностей использования Словаря фитонимов Среднего Приобья для нужд диалектной мотивологии. Рассматриваются информативные возможности словаря для решения задач описательного, функционального и лексикографического аспектов мотивологии. Источниковедческий аспект той или иной...»

«Федеральное агентство по образованию Владивостокский государственный университет экономики и сервиса В.М. ГРИНЯК, Е.И. КОГАЙ ИНФОРМАЦИОННЫЕ ТЕХНОЛОГИИ УПРАВЛЕНИЯ ТОРГОВЛЕЙ Практикум Владивосток Издательство ВГУЭС 2010 ББК 65.01 Г 85 Рецензенты: П.В. Зиновьев, доцент кафедры ММ, ДВГТУ; С.М. Моисеев, директор фирмы Созвездие, г. Владивосток Гриняк, В.М., Когай, Е.И. ИНФОРМАЦИОННЫЕ ТЕХНОЛОГИИ УПГ 85 РАВЛЕНИЯ ТОРГОВЛЕЙ [Текст] : практикум. – Владивосток : Изд-во ВГУЭС, 2010. – 152 с. Рассмотрены...»

«ТЕОРИЯ И МЕТОДОЛОГИЯ УДК 336.722.112:316 Т. А. Аймалетдинов О ПОДХОДАХ К ИССЛЕДОВАНИЮ ЛОЯЛЬНОСТИ КЛИЕНТОВ В БАНКОВСКОЙ СФЕРЕ АЙМАЛЕТДИНОВ Тимур Алиевич - директор по исследованиям ЗАО НАФИ, кандидат социологических наук, доцент кафедры социальной и педагогической информатики РГСУ. Email: aimaletdinov@nacfin.ru Аннотация. В статье приводится обзор классических и современных подходов к теоретической интерпретации и эмпирическим исследованиям лояльности клиентов к банкам. На основе анализа...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ ИНДУСТРИАЛЬНЫЙ УНИВЕРСИТЕТ (ФГБОУ ВПО МГИУ) Кафедра информационных систем и технологий ВЫПУСКНАЯ КВАЛИФИКАЦИОННАЯ РАБОТА по направлению 230100 Информатика и вычислительная техника на тему Разработка редактора сценариев и визуализатора отчетов для тестирования в рамках единой ERP системы ФГБОУ ВПО МГИУ Студент...»

«Учредитель Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Южно-Уральский государственный университет (национальный исследовательский университет) Основной целью издания является пропаганда научных исследований в следующих областях: Вычислительная математика и численные методы • Информатика • Математическое программирование • Математическое и программное обеспечение • Распознавание образов высокопроизводительных вычислительных систем •...»

«Министерство образования и науки Российской Федерации ФГАОУ ВПО УрФУ имени первого Президента России Б.Н. Ельцина Г.Ю. Кудряшова, О.М. Бычкова, Т.В. Мотовилова, Г.С. Щербинина Библиотеки вузов Урала: проблемы и опыт работы Выпуск 9 Научное электронное издание Подготовлено секцией информатизации библиотечного дела Научный редактор: канд. пед. наук Г.С. Щербинина Научно-практический сборник издается с 2002 года Зональной научной библиотекой Уральского федерального университета имени первого...»

«Направление подготовки: 010300.68 Фундаментальная информатика и информационные технологии (очная, очно-заочная) Объектами профессиональной деятельности магистра фундаментальной информатики и информационных технологий являются научно-исследовательские и опытноконструкторские проекты, математические, информационные, имитационные модели систем и процессов; программное и информационное обеспечение компьютерных средств, информационных систем; языки программирования, языки описания информационных...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФЕДЕРАЛЬНОЕ АГЕНСТВО ПО ОБРАЗОВАНИЮ САНКТ-ПЕТЕРБУРГСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ЭКОНОМИЧЕСКИЙ ФАКУЛЬТЕТ Кафедра информационных систем в экономике ДОПУСТИТЬ К ЗАЩИТЕ Заведующий кафедрой информационных систем в экономике Халин В. Г. “_”_2006 г. ДИПЛОМНЫЙ ПРОЕКТ По специальности 351400 “Прикладная информатика в экономике” На тему Проблемы формирования налоговой политики РФ в сфере IT-индустрии Студента Кошелевой Екатерины Алексеевны...»

«Высшее профессиональное образование БакалаВриат а. н. тетиор экология городской среды УЧеБник Для студентов учреждений высшего профессионального образования, обучающихся по направлению Строительство 4-е издание, переработанное и дополненное УДК 574(075.8) ББК 20.1я73 Т37 Р е ц е н з е н т ы: д-р архитектуры, проф., академик Международной академии информатизации и Академии проблем качества, советник РААСН, почетный архитектор России, ведущий научный сотрудник ЦНИИПромзданий Б.С.Истомин;...»

«Альманах Лицей 2 Содержание Открытие америк 3 Новости 4 Неделя информатики в лицее 4 Материалы школьного конкурса компьютерного рисунка 5 Человек на чужой планете 5 От первого лица 6 Счастливая случайность 6 В свободное время 7 Другой мир 7 Книжная полка 8 Воспользуйтесь тем, что вы живы, чтобы действовать. 8 Смиренномудрие 8 Король, дама, валет 9 За тридевять земель Нелёгкий спуск Коротко о главном Моё открытие Проба пера Волшебный сад Первооткрыватели Непостижимое и загадочное Главное...»

«СОДЕРЖАНИЕ Определение ООП.. 1 4 Характеристика профессиональной деятельности выпускника ООП 2 бакалавриата по направлению подготовки 230700.62 – Прикладная информатика.. 7 Компетенции выпускника ООП бакалавриата, формируемые 3 в результате освоения данной ООП ВПО. 9 Документы, регламентирующие содержание и организацию образовательного процесса при реализации ООП бакалавриата по направлению подготовки 230700.62 – Прикладная информатика. 12 Фактическое ресурсное обеспечение ООП бакалавриата...»

«В. И. Донской Алгоритмические модели обучения классификации: обоснование, сравнение, выбор Симферополь ДИАЙПИ 2014 УДК 519.7 ББК 22.12, 32.81 Д676 Донской В. И. Д676 Алгоритмические модели обучения классификации: обоснование, сравнение, выбор. – Симферополь: ДИАЙПИ, 2014. – 228 с. ISBN 978–966–491–534–9 В книге рассматриваются теоретические аспекты машинного обучения классификации. В центре изложения – обучаемость как способность применяемых алгоритмов обеспечивать эмпирическое обобщение. С...»






 
© 2014 www.kniga.seluk.ru - «Бесплатная электронная библиотека - Книги, пособия, учебники, издания, публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.