WWW.KNIGA.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Книги, пособия, учебники, издания, публикации

 

Pages:   || 2 |

«2 3 РЕФЕРАТ Отчет 95 с., 1 ч., 26 рис., 25 табл., 93 источника. РАК ЖЕЛУДКА, ПРОТЕОМНЫЕ МАРКЕРЫ, ЭКСПРЕССИЯ ГЕНОВ, ИММУНОГИСТОХИМИЧЕСКИЙ МЕТОД, КЛОНИРОВАНИЕ Объектом ...»

-- [ Страница 1 ] --

2

3

РЕФЕРАТ

Отчет 95 с., 1 ч., 26 рис., 25 табл., 93 источника.

РАК ЖЕЛУДКА, ПРОТЕОМНЫЕ МАРКЕРЫ, ЭКСПРЕССИЯ ГЕНОВ,

ИММУНОГИСТОХИМИЧЕСКИЙ МЕТОД, КЛОНИРОВАНИЕ

Объектом исследования являются протеомные маркеры

злокачественных опухолей желудка диффузного и интестинального типов.

Цель выполнения НИР. Идентификация наиболее информативных протеомных маркеров для диагностики, прогнозирования и послеоперационного мониторинга рака желудка (РЖ) интестинального и диффузного типа; создание высокочувствительных тест-систем для детекции идентифицированных маркеров в биологических образцах. Выполнение НИР должно обеспечивать достижение научных результатов мирового уровня, подготовку и закрепление в сфере науки и образования научных и научнопедагогических кадров, формирование эффективных и жизнеспособных научных коллективов.

Цель работы четвертого этапа — оценка эффективности тестирования выбранных белковых маркеров в крови и клонирование фрагментов белков.

Нами не были получены надлежащие результаты в ходе оценки уровня ингибина в сыворотки крови пациентов с РЖ ввиду объективных обстоятельств, связанных с принадлежностью INHBA к минорным белкам сыворотки крови, а также отсутствием коммерчески-доступных анти- INHBA антител, полученных от разных видов животных. Проведена оценка прогностической значимости белка AKR1B10. Проведено клонирование фрагментов белков и Нуклеотидные INHBA, PI3 AKR1B10.

последовательности, соответствующие выбранным фрагментам, были клонированы в плазмидные векторы систем pQE и pET. Проводится скрининг различных систем экспрессии рекомбинантных белков, для выбора наиболее оптимальной. Осуществлен иммуноферментный анализ сывороток здоровых доноров на наличие пепсиногена и антител к H.pilory.

Проведены исследования по сравнительной оценке уровня экспрессии генов TXN, WNT4, HSPG2, CTGF, EFEMP1 и FGF12 методом ПЦР с обратной транскрипцией, а также по оценке синтеза белка Trx методом Вестерн-блот анализа с использованием коммерческих АТ в парных образцах ткани нормальной слизистой и рака желудка, полученных при оперативном вмешательстве от больных с интестинальным и диффузным типом рака желудка. Дополнены базы данных и банк биообразцов.




Осуществлен анализ результатов мониторинга (динамического наблюдения) больных РЖ, включенных в исследование.

Результаты, полученные при проведении этапа работы.

Выявленный нами потенциальный маркер сывороточной диагностики рака желудка ингибин не удалось протестировать в сыворотке крови больных РЖ в связи с наличием таких объективных обстоятельств, как его принадлежность к минорным белкам сыворотки крови, а также отсутствие на мировом рынке коммерчески-доступных анти- INHBA антител, полученных от разных видов животных. Иммуногистохимический анализ экспрессии белка AKR1B10 выявил его прогностическую значимость в отношении гематогенного метастазирования у больных с интестинальным типом рака желудка, а также различия в уровне его экспрессии в опухолях диффузного и интестинального гистологических типов.

Оценка филогенетического родства и поиск гомологов с применением пакета программ Vector NTI 11.5 показали, что первичная структура этих белков человека высоко консервативна, что делает их слабо-иммуногенными для индукции полноценного иммунного ответа у лабораторных животных.

Для предсказания локализации антигенных детерминант в белках-мишенях был применен полуэмпирический метод, предложенный и Kolaskar Tongaonkar, позволивший выбрать полипептидные фрагменты для наработки антител. Проведены исследования генной экспрессии потенциальных белковых маркеров, выявленных в результате биоинформатического анализа по микроРНК. Дополнена база данных клинического материала по больным раком желудка. Представлены результаты мониторинга больных РЖ после проведенного лечения.

Представлен научно-технический отчет. Достигнуты заявленные значения программных индикаторов и показателей по подготовке и закреплению в сфере науки молодых научных кадров.

СОДЕРЖАНИЕ

ВВЕДЕНИЕ……………………………………………………………………….

ОСНОВНАЯ ЧАСТЬ

1 Анализ сывороток крови больных и здоровых лиц на наличие выявленных белков с использованием коммерческих антител…………………………….. 1.1. Анализ сывороток крови от больных раком желудка и здоровых лиц на наличие белка INHBA с использованием коммерческих антител…………… 1.1.1 Анализ экспрессии белка AKR1B10 в опухолях желудка…….... 1.2 Тестирование сывороток здоровых лиц на пепсиноген и антитела к H.

pylori……………………………………………………………………………… 1.3 Исследование уровня синтеза белка Trx-2 в опухолевой и нормальной ткани больных РЖ методом Вестерн-блот анализа………………………….. 1.3.1 Оценка уровня экспрессии белка Trx-2 в опухолевых и нормальных образцах рака желудка методом вестерн-блот-анализа с использованием коммерческих антител……………………………………….. 2 Клонирование белков (или их фрагментов) в бактериях, синтез и очистка антигена…………………………………………………………………………. 3 Оценка экспрессии генов выявленных белков методом ОТ-ПЦР в реальном времени у больных РЖ с опухолями интестинального и диффузного типа………………………………………………………………………………. 4 Сбор образцов биопсийного и операционного материала, крови больных и образцов крови здоровых доноров с клинико-морфологической характеристикой……………………………………………………………….... ЗАКЛЮЧЕНИЕ.…………………….……………….………….………………. СПИСОК ИСПОЛЬЗОВАННЫХ ИСТОЧНИКОВ.………..……….…………

ВВЕДЕНИЕ





Доказано, что ранняя первичная диагностика большинства типов злокачественных опухолей, а также точный прогноз клинического течения заболевания значительно повышают вероятность эффективного лечения.

Однако проблема поиска информативных диагностических и прогностических молекулярных маркеров, в том числе белковой природы, не решена для большинства наиболее распространённых видов опухолей в связи с высокой вариабельностью механизмов канцерогенеза и отсутствием высокочувствительных методов идентификации опухолевых маркеров.

Большинство опухолей желудка относится к карциномам и подразделяется на два основных гистологических подтипа: интестинальные и диффузные опухоли, которые имеют разный молекулярный патогенез и прогноз клинического течения. Это делает целесообразным поиск маркеров, ассоциированных с тем или иным типом РЖ, которые могли бы выступать, во-первых, в качестве дифференциальных критериев диагностики, а, вовторых, использоваться для прогноза. Несмотря на достаточно интенсивные поиски, в клинической практике пока нет новых эффективно работающих маркеров РЖ.

Главные цели проекта: Идентификация наиболее информативных протеомных маркеров для диагностики, прогнозирования и послеоперационного мониторинга РЖ интестинального и диффузного типа;

создание высокочувствительных тест-систем для детекции идентифицированных маркеров в биологических образцах. Выполнение НИР должно обеспечивать достижение научных результатов мирового уровня, подготовку и закрепление в сфере науки и образования научных и научнопедагогических кадров, формирование эффективных и жизнеспособных научных коллективов.

Достижение заявленных целей потребует решения следующих задач.

1. Идентификация потенциальных протеомных маркеров рака желудка различных гистологических типов.

2. Поиск белков со стабильным повышением синтеза в опухолях желудка.

3. Отбор диагностических и прогностических маркеров рака желудка.

4. Оценка эффективности детекции маркеров.

5. Создание и тестирование наборов для ранней диагностики и прогнозирования течения заболевания.

В процессе выполнения первого и второго этапов работы был проведен анализ научно-технической литературы, нормативно-технической документации и других материалов по теме проекта, выполнены патентные исследования, что позволило обосновать актуальность выбранного направления исследований. На базе клиники НИИ онкологии СО РАМН собраны парные образцы опухолей и нормальных тканей, полученных при интестинальным типами первично-диагностированного рака желудка.

Сформирован банк образцов крови (сывороток), а также тканей в парафиновых блоках. Все образцы тканей снабжены полной клинической документацией и охарактеризованы гистологически, диагноз подтвержден.

Сформирован банк данных парафиновых блоков (от 120 пациентов с прослеженной историей после лечения).

Поиск потенциальных диагностических и прогностических белковых маркеров рака желудка был осуществлен двумя методами. Первый - с биоинформационного поиска по анализу экспрессии мРНК и микроРНК с использованием современных баз данных: dbEST, SAGE и Oncomine. Второй – на основе протеомных исследований, которые были проведены с использованием 2D электорофореза большого формата на материале замороженных пар образцов нормальной и опухолей слизистой желудка.

Белки с повышенной концентрацией в опухоли идентифицированы массспектрометрически Подтверждение стабильного повышения генной экспрессии и синтеза выбранных потенциальных белковых маркеров в опухоли по сравнению с нормальной слизистой желудка было проведено методом ПЦР в реальном времени с обратной транскрипцией и методом Вестерн-блота с использованием коммерческих антител.

В данное исследование были включены следующие гены: AKR1B10, GPRC5A, CEACAM6, PI3, SOD2, STK31, NEK6, INHBA, CLDN6, CTGF, FGF12, EFEMP1, GPNMB, HSPG2, PMEPA1, SPARC, TXN, WNT4 и PPIA. В результате проведенного анализа, было выявлено статистически значимое повышение уровня экспрессии генов INHBA, SPARC и PMEPA1 в опухолевой ткани по сравнению с нормой, а также понижение в опухоли уровня экспрессии гена AKR1B10. В опухоли диффузного гистологического типа по сравнению с соответствующей нормой, наблюдалось повышение уровня экспрессии гена FGF12, в опухоли интестинального типа - понижение экспрессии WNT4 и повышение INHBA и S100 в опухолях кишечного типа.

Кроме того, было показано, что опухоль интестинального гистологического типа, по сравнению с диффузным, характеризуется повышенным уровнем экспрессии гена PI3 и пониженным уровнем экспрессии гена CTGF.

Вестерн-блот анализ с использованием коммерческих антителх к этим белкам не выявил сигнала, как в тотальных белковых экстрактах, так и в отдельных фракциях растворимых и нерастворимых белков, полученных после экстракции белков из образцов опухолей и нормальных тканей желудка солевым буфером. Контрольные эксперименты показали, что это связано: 1) с недостаточной чувствительностью коммерческих антител; 2) с низким уровнем синтеза идентифицированных белков в нормальных и опухолевых тканях.

На третьем и четвертом этапе исследование уровня транскрипции мРНК и синтеза белков было продолжено для ряда потенциальных белковмаркеров, которые не вошли в исследование при выполнении второго этапа НИР. Кроме того, была проведена оценка прогностической значимости нескольких белков по их экспрессии в ткани опухоли in situ иммуногистохимическим методом с использованием коммерческих антител и сопоставления уровня экспрессии этих белков с клинико-патологическими параметрами развития опухоли.

В рамках решения запланированных на 4-й этап задач проведены следующие исследования:

1 Анализ сывороток крови больных и здоровых лиц на наличие выявленных белков с использованием коммерческих антител.

2 Клонирование белков (или их фрагментов) в бактериях, синтез и очистка антигена.

3 Оценка экспрессии генов выявленных белков методом ОТ-ПЦР в реальном времени у больных РЖ с опухолями интестинального и диффузного типа.

4 Сбор образцов биопсийного и операционного материала, крови больных и образцов крови здоровых доноров с клинико-морфологической характеристикой.

Нам важно было выяснить для нашего исследования, в каком из гистологических типов рака желудка – диффузном или интестинальном – наблюдается повышение экспрессии того или иного белка. Однако в базах данных далеко не всегда представлены эти сведения. Поэтому мы сочли возможным пополнить список потенциальных маркеров для оценки прогноза на основе данных, полученных нами ранее при проведении исследований в рамках других проектов НИР.

Анализ синтеза исследуемых белков в парных образцах замороженных тканей опухолей и нормальной слизистой желудка, полученных при оперативном вмешательстве у больных раком желудка, методом Вестернблоттинга позволяет получить данные о различиях уровня синтеза белка в опухоли и нормальной ткани одного и того же пациента, при этом исключается проблема межиндивидуальных различий синтеза белка.

Вестерн-блот является необходимым этапом исследований в данной области, поскольку высокий уровень экспрессии мРНК не всегда соответствует высокому уровню синтеза белка вследствие дополнительной регуляции его экспрессии на уровне трансляции. Однако использование коммерческих антител не всегда позволяет обнаружить белки средней копийности, так как антитела недостаточно чувствительны. В этой связи обязательным этапом наших исследований было проведение оценки экспрессии мРНК методом ПЦР с обратной транскрипцией. Задача анализа выявленных потенциальных белков в сыворотке крови оказалась трудновыполнимой в связи с рядом объективных обстоятельств, что побудило нас провести исследование прогностической эффективности нерастворимого белка AKR1B10.

репрезентативные выборки больных, поэтому практически на всех этапах выполнения НИР предполагается пополнение регистра больных раком желудка, банка образцов биологического материала, а также формирование группы условно здоровых доноров.

Все вышесказанное определило проведение исследований, результаты которых представлены в отчете. В исследованиях активное участие принимали студенты и аспиранты Томского государственного университета и Сибирского государственного медицинского университета. Полученные новые сведения будут включены в образовательные программы обучения постдипломного образования ординаторов и аспирантов, выполняющих квалификационные работы по онкологии, патофизиологии, биохимии, иммунологии, программы научно-практических семинаров и конференций для молодых ученых и специалистов практического здравоохранения региона Сибири и Дальнего Востока.

ОСНОВНАЯ ЧАСТЬ

1 Анализ сывороток крови больных и здоровых лиц на наличие выявленных белков с использованием коммерческих антител 1.1. Анализ сывороток крови от больных раком желудка и здоровых лиц на наличие белка INHBA с использованием коммерческих антител Проведенный на предыдущих этапах поиск потенциальных маркеров рака желудка выявил большой список белков, включающий AKR1B10, GPRC5A, CEACAM6, PI3, SOD2, STK31, NEK6, INHBA, CLDN6, CTGF, FGF12, EFEMP1, GPNMB, HSPG2, PMEPA1, SPARC, TXN, WNT4 и PPIA. В результате проведенных работ по скринингу библиотеки белков, обладающих диагностическим потенциалом для обнаружения и стратификации различных форм рака желудка, были отобраны следующие полипептиды:

- Ингибин А (INHBA) Мw ~13 кДа (116 аминокислотных остатков), pI = 7.07;

секретируемый полипептид, относящийся к семейству трансформирующих факторов роста, вовлечен в целый ряд физиологических процессов, от развития фолликулов яичников до регуляции синтеза интерферона и дифференцировки клеток иммунной системы.

- Элафин или эластаза-специфический ингибитор (PI3) Мw ~ 6 кДа ( аминокислотных остатков), pI = 8.51; секретируемый пептид, относится к эпителиальным ингибиторам протеаз, предполагается, что он играет важную роль в регуляции процессов воспаления и в защите от тканевых повреждений в многослойном эпителии, а также обладает выраженным анти-микробным действием.

- Альдо-кето редуктаза семейства 1 член Б10 (AKR1B10) Мw ~ 36 кДа ( относящийся к семейству, альдо-кето редуктаз, экспериментально подтверждена высокая эффективность данного фермента в реакциях восстановления алифатических и ароматических альдегидов, а также показана более низкая активность в отношении гексоз. Повышенный уровень экспрессии наблюдается в тканях надпочечников, тонкого кишечника и ободочной кишки.

Согласно поставленной задаче, планировалось тестирование указанных белков в сыворотке крови (для растворимых белков) либо в ткани опухоли больных раком желудка с использованием коммерческих антител.

При разработке тактики проведения иммунохимической детекции ингибина А в сыворотках пациентов с РЖ был выявлен ряд объективных трудностей. Основным препятствием для нас явилось то, что INHBA относится к минорным компонентам сыворотки крови человека и не может быть напрямую определен методом иммуноблоттинга в клиническом материале. Нами рассматривался вариант постановки экспериментов с использованием гибридизации макромолекул путём диффузии через точечные отверстия в матрице (т.н. дот-блот), но было установлено, что коммерчески-доступное антитело анти-INHBA (фирмы Novus), имевшееся в нашем распоряжении, обладает не только очень низким пределом обнаружения искомого антигена, но также направлено к форме ингибина А, содержащей аминокислотную последовательность про-пептида, что также негативно влияет на качество выполняемого анализа.

многократном повышении уровня его экспрессии в организме, крайне маловероятным представляется возможность его косвенного определения посредством обнаружения ауто-антител в образцах сыворотки крови пациентов. Нами разрабатывается метод иммуноферментного определения содержания INHBA, основанный на так называемом «сэндвич» варианте твердофазного ИФА, позволяющем не только качественно, но и количественно определить содержание искомого антигена. Для этого планируется получить не только полноразмерный рекомбинантный ингибин человека, который будет использоваться в качестве стандарта концентрации антигена, но, также и синтетические пептиды-миметики антигенных детерминант для последующего получения антител от различных лабораторных животных. Описание предпринятых и планируемых далее исследований по клонированию и наработке пептида для иммунизации и получения высокоаффинных антител к ингибину приведено во втором разделе Основной части отчета.

В то же время стабильное изменение экспрессии гена AKR1B10 в опухолях по сравнению с нормальной слизистой и различия в уровне экспрессии между диффузным и интестинальным типом рака желудка сделало целесообразным проведение тестирования прогностической значимости белка AKR1B10 для больных раком желудка. Аргументом для этого послужили также данные Кропотовой и соавт. [1], которые показали снижение экспрессии указанного белка в опухоли толстого кишечника и ассоциацию экспрессии с клинико-патологическими факторами заболевания.

Принимая во внимание неудовлетворительные результаты по задаче тестирования белков в сыворотке крови, мы сочли возможным провести сопоставимое по трудозатратам, техническому исполнению и в соответствии с одной из задач настоящего проекта, тестирование белка AKR1B10 в опухолях желудка у больных с известными результатами отдаленного наблюдения после проведенного лечения, с тем, чтобы оценить его прогностический потенциал. Данные представлены в следующем параграфе.

1.1.1 Анализ экспрессии белка AKR1B10 в опухолях желудка AKR1B10 является НАД (Ф)-зависимой оксидоредуктазой (также обусловливает ее важную роль в метаболизме ксенобиотиков и при воспалительных процессах различного генеза [2]. Есть сведения об участии AKR1B10 в метаболическом пути ретиноевой кислоты, которая регулирует дифференцировку и опосредует супрессию роста трансформированных клеток [3]. AKR1B10 – альдо-кето редуктаза I B10 семейства. Альдо-кеторедуктазы являются НАД Н-зависимыми ферментами, которые катализируют разрушение различных карбонильных связей, что обусловливает их важную роль в метаболизме стероидов, а так же в детоксикации реактивных альдегидов в перевариваемой пище. AKR1B содержится во многих тканях, но в основном обнаруживается в тонком кишечнике, прямой кишке, надпочечниках. Имеются сведения об участии AKR1B10 в метаболическом пути ретиноевой кислоты, которая регулирует дифференцировку и росто-супрессивные эффекты в различных предраковых и раковых клетках. В легких недостаток ретиноида является причиной гиперплазии и плоскоклеточной метаплазии респираторного эпителия. Кроме того, отмечена экспрессия AKR1B10 при опухолях печени, молочной железы. Локализуется в цитоплазме клеток. Экспрессия AKR1B10 выражена в немелкоклеточном раке легкого и аденокарциномах, при этом стоит особо отметить, что повышение экспрессии связано с фактом курения, который присущ подавляющему большинству больных раком легкого [4]. Известно, что AKR1B10 может играть роль в регуляции пролиферации клеток и клеточного ответа при карбонильном стрессе. Ген AKR1B10, ответственный за активацию глицеролипидного метаболизма в эксперименте экспрессировался в более низких уровнях в образцах с аденокарциномами пищевода и кардиоэзофагиальных раках, а также при кишечном типе рака желудка в сравнении с образцами с кишечной метаплазией эпителия, однако следует отметить, что в данной работе было исследовано всего 7 образцов ткани опухоли желудка [6].

Недавно российскими исследователями впервые были показаны существенные различия в экспрессии белка AKR1B10 в опухолях кишечника по сравнению с нормальной тканью [1]. Принимая во внимание важную роль указанного фермента в осуществлении детоксикации, его вовлечение в сигнальные пути ретиноевой кислоты, а, следовательно, регуляцию пролиферации и дифференцировки клеток, можно предполагать его участие в патогенезе рака желудка.

Данных о дифференциальной экспрессии AKR1B10 в опухолевой и нормальной ткани желудка практически нет, если не принимать во внимание вышеуказанную статью Gomes L.I., 2005 [5], в которой выборка больных не может рассматриваться как репрезентативная. Мы изучили экспрессию гена AKR1B10 в парных образцах опухолей и нормальной ткани желудка с помощью метода обратной транскрипции и ПЦР в режиме реального времени. При сравнительном анализе уровня экспрессии гена AKR1B10 с уровнем экспрессии референс-контроля (ген AСTB) в 45 парах образцов опухолевой и нормальной ткани было показано двукратное снижение среднего группового уровня мРНК в опухоли по сравнению с нормальной слизистой; изменение экспрессии мРНК у разных пациентов колебалось от до 342 раз. При этом не менее, чем двукратное снижение экспрессии данного гена наблюдалось в клетках опухоли у 49% обследуемых. В клетках опухолей как диффузного, так и интестинального типа, экспрессия данного гена была значимо понижена по сравнению с нормальной тканью (p=0,006 и 0,001), а средняя относительная экспрессия составила 0,090±0,016 и 0,145±0,040 против 0,275±0,07 и 0,254±0,05 соответственно. При этом кратность изменения уровня экспрессии варьировала от 2 до 75 при диффузном типе и от 2 до 342 при интестинальном гистотипе рака желудка.

Схожая картина наблюдалась и при разделении группы больных по основным клинико-патологическим показателям. По сравнению с нормальной тканью, наблюдалось значимое понижение экспрессии гена AKR1B10 в группе с большим размером первичной опухоли (понижение в 47% опухолей на стадии T3-T4, варьирование от 2 до 342, p=0,0005) и у 81% больных c наличием метастазов в регионарные лимфоузлы (группа N1-N3, понижение экспрессии от 2 до 342, p=0,002). При сравнении нормальной ткани с опухолями больных без метастазов в регионарные лимфоузлы (N0), значимых различий получено не было. Показано, что понижение экспрессии гена AKR1B10 происходит как в диффузных, так и в интестинальных опухолях, метастазирующих в лимфоузлы уже на ранних стадиях процесса канцерогенеза. Этот факт свидетельствует о вовлечении белка AKR1B10 в механизмы прогрессирования опухолевого процесса, связанные с вовлечением региональных лимфатических узлов.

Данные о различиях в генной экспрессии AKR1B10 между опухолью и нормальной слизистой желудка, и связь этих изменений с прогрессией заболевания указывает на целесообразность оценки его прогностической значимости. Мы провели оценку связи экспрессии белка AKR1B10 с клинико-патологическими особенностями диффузного и кишечного гистотипов РЖ у больных, для которых известны отдаленные результаты лечения в период от 1 до 6 лет мониторинга. Анализ экспрессии белка в клетках опухоли на срезах ткани из парафиновых блоков проводили с использованием коммерческих антител к AKR1B10 и визуализирующей системы иммуногистохимическим методом, с оценкой результата в световом микроскопе. Для подтверждения диагностической и/или прогностической значимости необходимо было оценить особенности экспрессии белка AKR1B10 в опухолевых клетках при кишечном и диффузном типах рака желудка. В исследование вошло 29 пациентов с кишечным типом рака желудка стадии T1-4N0-3M0, из них 52% мужчин и 48% женщин. Средний возраст больных 62,1±7,3 лет. Предоперационного лечения больным не проводилось. Операция выполнялась в объеме субтотальной дистальной резекции желудка, гастроэктомии, проксимальной резекции желудка, паллиативной субтотальной резекции желудка, операции Бильрот 2.

Гистологический тип рака желудка устанавливался согласно классификации, предложенной [6] Lauren P., 1965. Иммуногистохимическое исследование первичные/специфичные антитела (анти-AKR1B10) в рабочем разведении 1:

300. Выраженность экспрессии определялась по проценту клеток с позитивной цитоплазматической экспрессией изучаемого маркера при большом увеличении микроскопа (х400). Оценивали экспрессию AKR1B10 в клетках, формирующих железистоподобные, криброзные, солидные, трабекулярные структуры, а также в дискретных группах опухолевых клеток (рисунки 1-4) Рисунок 1. Экспрессия AKR1B10 в железистоподобных структурах в Рисунок 2. Экспрессия AKR1B10 в криброзных структурах в кишечном типе Рисунок 3. Экспрессия AKR1B10 в трабекулярных структурах в кишечном Рисунок 4. Экспрессия AKR1B10 в солидных структурах в кишечном типе Во всех случаях при кишечном и диффузном типах рака желудка эпителиальных клеток нормального и метаплазированного эпителия слизистой оболочки желудка, так и в цитоплазме опухолевых клеток. При диффузном типе рака желудка экспрессия была менее выраженной в сравнении с экспрессией AKR1B10 в цитоплазме клеточных элементов карциномы интестинального типа (таблица 1).

Таблица 1. Выраженность экспрессии AKR1B10 в опухолевых клетках с учетом типа рака желудка Примечание - F=13,9; р=0, Первичные опухоли, соответствующие критериям Т1, Т2, и Т4, определяемым согласно классификации ВОЗ по глубине инвазии стенки желудка, в группах пациентов с интестинальным и диффузным типами рака желудка встречались приблизительно с одинаковой частотой. При этом различий в экспрессии белка AKR1B10 у больных с диффузным и интестинальным типами рака желудка в зависимости от глубины инвазии опухоли не обнаружено (без учета гистологического варианта опухолевых структур) (таблица 2).

Таблица 2. Выраженность экспрессии протеина AKR1B10 в зависимости от глубины инвазии в первичной опухоли (Т) у больных с кишечным и диффузным типом рака желудка Глубина инвазии в Выраженность экспрессии, баллы (M±SD) Т1 (в подслизистый слой) 2,6±0,5 (n=8) 2,2±0,4 (n=5) Т3 (в серозную оболочку) 2,6±0,7 (n=11) 2,2±0,4 (n=6) При раздельном изучении уровня синтеза белка AKR1B10 в каждом из вариантов опухолевых структур с учетом глубины инвазии выявлены следующие закономерности. Оказалось, что при интестинальном типе рака железистоподобных и криброзных структур снижается (таблица 3).

Таблица 3. Процент экспрессии AKR1B10 в разных структурах опухоли при различной глубине инвазии их в стенке желудка у больных кишечным типом рака Тип структур Процент экспрессии протеина (M±S.D.) опухоли слизистый подслизистый мышечный серозный железистоподобные 87,2±16,9 79,9±22,7 73,4±31,2 36,7±30, железистоподобные 87,2±16,9 79,9±22,7 73,4±31,2 36,7±30, экспрессии белка AKR1B10 в группах клеток и перстневидно-клеточных элементах не зависел от глубины их расположения в стенке желудка (таблица 4).

Таблица 4. Процент экспрессии AKR1B10 в разных структурах опухоли при различной глубине инвазии их в стенке желудка у больных диффузным типом рака Тип структур Процент экспрессии протеина (M±S.D.) опухоли cлизистый подслизистый мышечный серозный группы клеток 70,4±26,3 68,8±26,7 68,4±30,9 66,8±36, Взаимосвязи между уровнем экспрессии белка AKR1B10 в опухолевых клетках и наличием лимфогенных метастазов у больных с обоими типами РЖ не обнаружено (F=0,03; р=0,85 и F=0,6; р=0,42, соответственно).

Отсутствовала также зависимость изучаемого показателя от количества пораженных метастазами лимфатических узлов (таблица 5).

Таблица 5. Выраженность экспрессии протеина AKR1B10 в зависимости от характеристик лифогенных метастазов (N) у больных с диффузным и кишечным типом рака желудка Характеристика Выраженность экспрессии, баллы (M±S.D.) метастазов (N) метастазами) метастазами) метастазами) лимфоузлов с метастазами) Не было выявлено и различий в экспрессии белка AKR1B10 в зависимости от локализации лимфогенных метастазов. Уровень экспрессии белка AKR1B10 также не различался в зависимости от развития локорегиональных рецидивов и не зависел от наличия гематогенных метастазов.

При диффузном типе рака желудка отмечалась тенденция к более частому возникновению летальных исходов, которые возникали либо вследствие прогрессирования злокачественного заболевания, либо вследствие послеоперационных осложнений, связанных с тромбозом сосудов бассейнов чревного ствола и воротной вены. В отличие от больных с интестинальным типом РЖ в группе больных с диффузным типом рака в случаях наступления летального исхода отмечено повышение экспрессии белка AKR1B (таблица 6).

Таблица 6. Выраженность экспрессии протеина AKR1B10 в зависимости от летальных исходов у больных с диффузным и кишечным типом рака желудка Летальные исходы Выраженность экспрессии, баллы (M±SD) При интестинальном типе рака желудка в случае летального исхода отмечалось снижение уровня экспрессии белка AKR1B10 в клетках, формирующих железистоподобные структуры, располагающиеся в слизистой оболочке (таблица 7).

Таблица 7. Процент экспрессии протеина AKR1B10 в разных структурах опухоли при различной глубине инвазии их в стенке желудка в зависимости от частоты наступления летальных исходов у больных кишечным типом рака Тип структур ЛИ Процент экспрессии протеина AKR1B10 (M±S.D.) опухоли слизистый подслизистый мышечный серозный Примечание - ЛИ- летальные исходы При диффузном типе РЖ в случае летального исхода отмечено опухолевых клеток, располагающихся в серозной оболочке (таблица 8) Таблица 8. Процент экспрессии протеина AKR1B10 в разных структурах опухоли при различной глубине инвазии их в стенке желудка в зависимости от частоты наступления летальных исходов у больных диффузным типом рака Тип структур Процент экспрессии протеина AKR1B10 (M±S.D.) опухоли cлизистый подслизистый мышечный серозный группы клеток нет 69,7±20,7 70,0±27,3 77,3±20,8 27,0±7, Примечание - ЛИ - летальные исходы Таким образом, интестинальный и диффузный типы опухолей отличаются по выраженности экспрессии белка AKR1B10 в клетках новообразования, что свидетельствует о дифференциальной прогностической значимости этого белка. Уровень экспрессии белка AKR1B10 понижался заметно сильнее при диффузном типе рака желудка по сравнению с интестинальным типом рака и в сравнении с метаплазированной слизистой оболочкой желудка. При интестинальном типе рака желудка экспрессия белка AKR1B10 в опухолевых клетках более дифференцированных железистоподобных и криброзных структур снижается по мере инвазии опухоли в стенку желудка. Уровень экспрессии белка AKR1B10 не связан с лимфогенным метастазированием как при интестинальном, так и при диффузном типе рака желудка. В случае летального исхода при интестинальном типе рака отмечается понижение экспрессии белка AKR1B10 в железистоподобных структурах слизистой оболочки. В отличие от интестинальных опухолей, при диффузном типе рака желудка нет заметной связи между уровнем экспрессии белка AKR1B10 с одной стороны и глубиной инвазии, лимфогенным метастазированием и летальностью - с другой. Существенные различия в характере и интенсивности белковой экспрессии AKR1B10 в клетках диффузных и интестинальных опухолей указывают на разные механизмы его вовлечения в патогенез РЖ.

Полученные данные свидетельствуют об актуальности дальнейших исследований белка AKR1B10 с целью валидации его диагностической и прогностической значимости на соответствующих выборках больных.

В настоящем исследовании представлены новые данные о генной и гистологических типов. Ранее, повышение уровня синтеза этого белка было обнаружено в опухолях легких (немелко-клеточный рак), печени и ротовой полости у курильщиков [7 - 9]. Это объясняется тем, что альдокеторедуктаза AKR1B10 является одним из ключевых ферментов осуществляющих детоксификацию ряда гипер-реактивных альдегидов частности, генерируемых в процессе расщепления пищи, метаболизма алкоголя, перекисного окисления липидов, а также содержащихся в табачном дыме). В альдокеторедуктазы AKR1B10 в опухолях желудка. Полученные нами результаты указывают на вовлечение AKR1B10 в патогенез РЖ и делают актуальными исследования по определению сигнальных путей его участия в канцерогенезе, которые могут привести к идентификации потенциальных мишеней для терапии опухолей. Впервые показана прогностическая значимость иммуногистохимической детекции белка AKR1B10 у больных с интестинальным типом РЖ. Эти данные могут послужить основой для создания прогностического теста РЖ.

По полученным результатам подана заявка на патент «Способ прогнозирования гематогенного метастазирования при кишечном типе рака желудка». Настоящий способ прогнозирования относится конкретно к определению вероятности развития гематогенных метастазов у больных с кишечным типом рака желудка при инвазии не менее чем до мышечного слоя стенки органа. Поставленная задача решается путем иммуногистохимической оценки процента экспрессии протеина AKR1B10 в клетках рака желудка кишечного типа, формирующих железистоподобные структуры, располагающиеся в слизистом, подслизистом, мышечном и серозном слоях стенки желудка.

При этом подсчитывается коэффициент регрессии с помощью метода множественной регрессии из пакета программ Statistica 6, for Windows. В качестве переменного параметра используется процент экспрессии AKR1B10 в слизистом, подслизистом, мышечном и серозном слоях стенки желудка. Если опухоль прорастает до мышечного слоя, то оценивается экспрессия только в трех слоях. В качестве независимого параметра используется показатель, отражающий наличие опухолевых структур в разных слоях стенки желудка: «1» - в слизистом слое, «2» подслизистом, «3» - мышечном, «4» - серозном. При значении коэффициента регрессии равном или более «-0,25» случай относят к группе высокого риска развития гематогенных метастазов. При значении коэффициента регрессии менее «-0,25» случай относят к группе низкого риска развития гематогенных метастазов. Были подсчитаны чувствительность и специфичность метода, а также отношение шансов. Чувствительность метода составила 67%, специфичность 92%, отношение шансов 22.

1.2 Тестирование сывороток здоровых лиц на пепсиноген и антитела к H. pylori Известно, что слизистая оболочка желудка вне зависимости от механизмов ее повреждения, может регенерировать и восстанавливать свою первоначальную структуру. Однако при прогрессировании воспалительного процесса в слизистой оболочке желудка (СОЖ) поврежденные железы теряют способность к регенерации, а специализированные гландулоциты, обеспечивающие секреторную функцию желудка, замещаются другими клетками (в том числе вырабатывающими слизь и метаплазированным эпителием). Таким образом, происходит развитие атрофического гастрита (АГ) – заболевания, отнесенного к состояниям, при которых значительно увеличивается риск возникновения рака желудка (РЖ) [10]. Наибольшую кислотообразующей функцией желудка (частота возникновения рака – до %). Хронический атрофический гастрит обнаруживается у 90 % больных РЖ.

Поэтому в настоящее время считают, что своевременная диагностика атрофии СОЖ должна стать первым этапом выявления риска по раку желудка [11].

Сложность ранней диагностики АГ заключается в том, что на начальных стадиях в течение длительного времени болезнь может развиваться бессимптомно или сопровождается лишь незначительными заболевания эндоскопическое исследование, позволяющее выявить устанавливают, проводя морфологический анализ проб биопсии, взятых во время эндоскопии. Атрофический гастрит подтверждается, если в биоптате пациента обнаружено снижение числа гландулоцитов и замещение их более простыми клетками, в частности, вырабатывающими слизь. Однако при следствием чего может быть гипер- и гиподиагностика атрофического гастрита [12].

В 80-х годах прошлого века американский гастроэнтеролог M. Samloff установил, что концентрация проферментов пепсина (пепсиногены 1 и 2) в сыворотке крови коррелирует с уровнем пептической секреции желудка и, что более важно, с тяжестью поражения СОЖ, что было подтверждено морфологически [13]. На основании этих и последующих исследований, результаты количественного анализа сывороточных пепсиногенов стали использовать для оценки состояния СОЖ [14, 15].

Пепсиногены – функционально неактивные белки-предшественники фермента пепсина, который образуется из них в присутствии соляной кислоты желудочного сока. В организме человека синтезируются два профермента пепсина: пепсиноген 1 (PG1) и пепсиноген 2 (PG2). Они отличаются строением молекул, иммунологическими свойствами и оптимальным значением рН, необходимым для превращения их в пепсин:

для PG1 1,5-2,0, а для PG2 - 4,5. Пепсиноген 1 продуцируется главными клетками желез дна и тела желудка, пепсиноген 2 – муцинообразующими клетками всех отделов желудка, а также бруннеровыми железами в проксимальной части двенадцатиперстной кишки. У здоровых людей количество секретируемого PG1 в 3 и более раз выше, чем PG2. Оба пепсиногена можно выявить в желудочном соке и в крови человека; в моче в норме определяется только PG1.

В последние годы в лабораториях ряда стран был проведен ряд исследований по замене скрининговой диагностики АГ с помощью эндоскопии на более эффективные неинвазивные методы. В результате этих работ было показано, что в качестве биологического маркера этого заболевания может быть использован PG1, концентрация которого в сыворотке крови коррелирует с тяжестью атрофии желудка, подтвержденной гистологически [14]. Уровень сывороточного PG1 отражает состояние секреторной функции слизистой оболочки желудка. Установлено, что при нормальном состоянии СОЖ концентрация PG1 в сыворотке крови жителей европейских стран варьирует в пределах 40–130 мкг/л [16]. При АГ заметно уменьшается секреция соляной кислоты и, как следствие, концентрация сывороточного PG1 снижается до значений менее 40 мкг/л [17].

Применение количественного анализа PG1 для диагностики АГ (в том числе его ранней бессимптомной формы) в настоящее время получило распространение во многих развитых странах, а в Японии этот метод уже включен в скрининговые исследования Чувствительность и специфичность метода составляет более 90 %, а достоверность получаемых результатов заметно выше, чем при использовании эндоскопии и гистологического исследования [19]. Следует отметить, что результаты определения PG1 при скрининговых исследованиях позволяют выделить из когорты обследуемых не только лиц с высоким риском развития рака желудка, но также вычленить пациентов, относящихся к группе риска по язве сывороточного PG1 выше 165 мкг/л) [20].

Ценную дополнительную информацию о состоянии СОЖ дает соотношения концентрации PG1/PG2. Установлено, что у здоровых жителей стран Западной Европы нормативные значения PG2 в сыворотке крови не выходят за пределы 2–15 мкг/л, а концентрация PG1 более чем в 3 раза выше уровня PG2 [21]. Превышение верхней границы нормы сывороточного PG2 – показатель, свидетельствующий о наличии у обследуемого человека воспаления СОЖ любой этиологии [22]. Показано, что соотношение концентрации PG1 и PG2 в сыворотке крови меньше 3 может быть использовано в качестве дополнительного диагностического критерия, подтверждающего атрофический гастрит тела желудка [23].

Результаты комплексного определения PG1, PG2 и соотношения PG1/PG2 позволяют дифференцировать функциональную диспепсию от серьезной органической гастропатологии (как опухолевой, так и иной этиологии), требующей для установления окончательного диагноза проведения дополнительных исследований.

В настоящее время комплексный анализ пепсиногенов широко применяется в лабораториях ряда стран для ежегодного скринингового обследования лиц старше 50 лет, а также для тестирования пациентов, относящихся к группе риска по раку желудка. В эту группу настоятельно рекомендуют включать близких родственников больных РЖ, пациентов, страдающих диспепсией, язвенной и гастроэзофагиальной рефлюксной болезнью, а также курящих мужчин старше 45 лет и часто болеющих лиц старшего возраста [24]. Кроме того, комплексный лабораторный анализ обследования лиц, которым ее проведение нежелательно в связи с заболеваниями сердечнососудистой системы. К достоинствам такого исследования относится также то, что анализ прост в исполнении, позволяет получить достоверные сведения о состоянии СОЖ всего за 1,5–2,0 ч, не травмируя ее, как при применении эндоскопии [25]. Это дает возможность проводить обследование пациентов оперативно по мере необходимости, а также в динамике.

исследований, проведённых в Финляндии, стало создание тестовой панели иммуноферментного анализа (ИФА), с помощью которой в плазме крови определяются 4 показателя: наличие антител IgG к Helicobacter pylori и их количество, уровни пепсиногена I, пепсиногена II и гастрина-17. По совокупности этих параметров становится возможным выявить факт инфицирования Helicobacter pylori, наличие атрофии, оценить степень и локализацию процесса.

технологии производства в ЗАО «Вектор-Бест» (Новосибирск) начат серийный выпуск наборов реагентов «Пепсиноген 1 – ИФА – БЕСТ» и «Пепсиноген 2 – ИФА – БЕСТ» для количественного определения PG1 и PG методом твердофазного иммуноферментного анализа. Были проведены сравнительные лабораторные исследования вышеупомянутых наборов назначения «Pepsinogen I» и ««Pepsinogen II» («Biohit», Финляндия), широко применяемых в лабораторной медицине многих стран.

Корреляционный анализ данных количественного определения PG1, PG2 и их соотношений в образцах сыворотки крови, полученных с помощью наборов реагентов «Пепсиноген 1 – ИФА – БЕСТ», «Пепсиноген 2 – ИФА – БЕСТ» и наборов сравнения («Biohit», Финляндия), показал хорошую сходимость результатов исследования (коэффициент корреляции для PG равен 0,93; для PG2 – 0,91; для PG1/PG2 – 0,84).

На следующем этапе исследований наборы реагентов «Пепсиноген 1 – ИФА – БЕСТ» и «Пепсиноген 2 – ИФА – БЕСТ» были использованы для определения нормальных значений PG1, PG2 и соотношения PG1/PG2 у жителей Западной Сибири. Необходимость проведения такой работы обусловлена тем, что нормальные концентрации пепсиногенов в сыворотке крови здоровых людей могут изменяться в зависимости от района проживания [25]. Это, очевидно, связано с социально-экономическими условиями, особенностями питания, а также распространенностью в данном регионе инфекции Helicobacter pylori [26]. На сегодняшний день доказано, что именно эта инфекция является одной из основных причин возникновения язвенной болезни и хронического атрофического гастрита [27].

Для комплексного исследования пепсиногенов использовали образцы сывороток 180 условно здоровых доноров из Новосибирска, Барнаула, Кемерова, Томска и Рубцовска, у которых отсутствовали жалобы, характерные для заболеваний желудка. В результате статистического анализа полученных экспериментальных данных были рассчитаны нормальные значения концентрации сывороточного PG1 (30–130 мкг/л), PG2 (4–22 мкг/л) и их соотношение (PG1/PG2 – больше 3) для здоровых жителей ЗападноСибирского региона.

На основании результатов проведенных исследований по определению концентрации сывороточных PG1, PG2 и их соотношения у большого числа пациентов с различным состоянием СОЖ, а также данных, опубликованных в научной литературе на эту тему, были составлены рекомендации по применению комплексного анализа пепсиногенов в клинической практике при некоторых заболеваниях желудочно-кишечного тракта (таблица 9) [28].

Таблица 9. Интерпретация результатов комплексного исследования пепсиногенов Примечания 1 -*- интервал нормальных значений 2 -**- при атрофических изменениях СОЖ снижена выработка внутреннего фактора Касла, что приводит к мальабсорбции витамина B12 и высокому уровню гомоцистеина в тканях и крови, возможно также развитие мальабсорбции кальция и железа 3 -***- чаще всего связан с инфекцией H. pylori К настоящему времени наборы реагентов «Пепсиноген 1 – ИФА – БЕСТ» и «Пепсиноген 2 – ИФА – БЕСТ» прошли апробацию и получили положительные отзывы ряда клинико-диагностических лабораторий из различных регионов страны. Опыт применения этих первых отечественных тестов для комплексного исследования пепсиногенов показал, что по показателям качества они не отличаются от импортных наборов аналогичного назначения, обеспечивают получение воспроизводимых и достоверных результатов анализа, однако при этом имеют заметно меньшую стоимость.

Учитывая вышеизложенное, мы в своем исследовании провели оценку значений пепсиногенов 1 и 2, а также наличие инфекции Helicobacter pylori в сыворотке 45 условно здоровых лиц, у которых отсутствовали характерные для заболеваний желудка жалобы.

Для измерения уровней Пепсиногенов I и II и количественного определения антител IgG к Helicobacter pylori использовали наборы для ИФА анализа компании «Вектор-Бест» (Новосибирск).

использованием данного метода для определения концентрации сывороточных пепсиногенов (PG1, PG2) и их соотношения, приведенные разработчиками тест-систем «Пепсиноген 1 – ИФА – БЕСТ» и «Пепсиноген – ИФА – БЕСТ», нами были проанализированы полученные результаты.

Из 45 обследованных лиц у 13 человек значения PG1, PG2 и их соотношение попали в диапазон значений, соответствующих диагнозу «слизистая оболочка желудка в норме» (таблица 10). Остальные 32 человека были отнесены в группы «неатрофический гастрит» и «гастрит любой этиологии (чаще связан с инфекцией H.pylori)» (рисунок 5).

слизистая оболочка желудка в норме неатрофический гастрит любой этиологии (может быть связан с инфекцией Рисунок 5 Распределение обследованных лиц по состоянию слизистой Прогнозом для этих групп людей является риск развития язвы 12перстной кишки или желудка и рекомендуется проведение анализа на наличие инфекции H. pylori, при положительном результате – эрадикация возбудителя, лечение гастрита и повторное исследование пепсиногенов через полгода.

Среди обследованных лиц не было выявлено людей с атрофическим гастритом.

Исследование на наличие антител к H. pylori в сыворотке обследуемых лиц показало, что инфицированными оказались 18 человек, сомнительный результат был получен в 12 случаях и у 15 человек отсутствовали антитела к H. pylori (рисунок 6).

Рисунок 6 Распределение обследованных лиц по результатам анализа на При этом инфицирование H.pylori наблюдалось как в группе людей со здоровой слизистой оболочкой желудка, так и у людей с явлениями гастрита (таблица 10).

Таблица 10. Частота встречаемости лиц, инфицированных H.pylori, с различными состояниями слизистой оболочки желудка отрицательный сомнительный положительный слизистая оболочка желудка в норме (n=13) неатрофический гастрит.

Болезнь Менетрие(n=5) гастрит любой этиологии инфекцией H.pylori) (n=27) Полученные результаты вполне согласуются с литературными данными о том, что этой инфекцией заражена почти половина человечества [29]. При этом, с одной стороны H. pylori можно рассматривать с определенными оговорками, как часть нормальной бактериальной флоры желудочно-кишечного тракта, которую не всегда нужно элиминировать со слизистой оболочки желудка. С другой стороны, почти у 50% лиц, инфицированных Helicobacter pylori, разовьётся атрофический гастрит, который в 90% случаев является причиной развития язвенной болезни и в большинстве случаев приводит к раку желудка. Эррадикация инфекции Helicobacter pylori Соответственно, уменьшается или полностью исчезает риск развития заболеваний, связанных с атрофическим гастритом [21, 22].

Таким образом, проведенное нами исследование показало, что, несмотря на отсутствие характерных для заболеваний желудка жалоб, не всех лиц, выбранных нами в качестве здоровых лиц можно отнести в группу контроля. Оценив значения уровней пепсиногенов 1 и 2 и их соотношение с учетом рекомендаций по лабораторной диагностике с использованием данного метода для определения концентрации сывороточных пепсиногенов (PG1, PG2) и их соотношения, приведенные разработчиками тест-систем «Пепсиноген 1 – ИФА – БЕСТ» и «Пепсиноген 2 – ИФА – БЕСТ», лишь человек были отнесены в группу с диагнозом «слизистая оболочка желудка в норме». Остальные 32 человека были отнесены в группы «неатрофический гастрит» и «гастрит любой этиологии (чаще связан с инфекцией H.pylori)» и не могут быть включены в контрольную группу.

1.3 Исследование уровня синтеза белка Trx-2 в опухолевой и нормальной ткани больных РЖ методом Вестерн-блот анализа Для подтверждения стабильного повышения синтеза белка Trx-2 в опухолях желудка использован метод Вестерн-блота (с использованием коммерческих антител), проведение которого позволяет уточнить результаты, полученные при оценке генной экспрессии, поскольку высокий уровень экспрессии мРНК не всегда соответствует высокому уровню синтеза белка вследствие дополнительной регуляции его экспрессии на уровне трансляции. Далее представлены результаты Вестерн-блот анализа с использованием коммерческих антител.

1.3.1 Оценка уровня экспрессии белка Trx-2 в опухолевых и нормальных образцах рака желудка методом вестерн-блот-анализа с использованием коммерческих антител Мы выявили изменение генной экспрессии белка Trx-2 в опухолевой ткани по сравнению с нормальной слизистой желудка (см.главу 3 настоящего отчета). Использованы антитела к белку Trx-2 (Cat. №SC-101512, Santa Cruz Biotechnology, Inc). На форез был нанесен тотальный экстракт опухолевой и нормальной ткани 7 пациентов.

Описание метода вестерн-блот-анализа с использованием системы SNAP id (Millipore). Разведение антител к Trx-2 - 1:1000 - 3 мкл в 3 мл 0.02кратном блокирующем буфере (рекомендовано 1:100-1:1000).

Белковые экстракты, содержащие 10 мкг белка в 10 мкл, подвергали разделению электрофорезом по методу Лэммли в градиентном полиакриламидном геле (10-20%). После разделения белки подвергали электропереносу на поливинил-дифторидную мембрану Immobilon-P Transfer Membrane (Millipore, США), используя mini Trans-Blot transfer cell (Bio-Rad, США) в соответствии с рекомендациями производителя. Мембрану после электропереноса белков смачивали в спирте, затем промывали в воде mQ. В контейнер наливали блокирующий буфер (PBS, 1% Tween-20 и 5% обезжиренное сухое молоко) и блокировали в течение 1 часа. Открывали держатель, смачивали подложку mQ водой, укладывали мембрану белками вниз, разглаживали, удаляли пузыри, затем сверху накладывали сухой спейсер и устанавливали контейнер для сбора раствора антител. Закрывали держатель, переворачивали, устанавливали его в прибор. Заливали раствор первичных антител к Trx-2 (1:1000), инкубировали в течение 10 минут, включали насос, откачивали раствор в контейнер, снимали контейнер.

Промывали 3 раза в течение 30 секунд 30 мл PBS с 0,01% Tween-20, при включенном насосе. Заливали вторичные антитела к иммуноглобулинам мыши в соотношении 1: 5 000 (1 мкл антител разводили в 5 мл 0.02-кратном блокирующем буфере), инкубировали 10 минут, включали насос. Затем промывали 3 раза 30 мл PBS-T, при включенном насосе. Мембрану, укладывали в кассету, удаляли лишнюю влагу салфеткой, инкубировали минут с растворами ECL (2 мл раствора А и 50 мкл – раствора В (Amersham ECL Plus™ Western Blotting Detection Reagents, Cat. № RPN2132, GE Healthcare). Затем мембраны экспонировали с рентгеновской пленкой (Amersham Hyperfilm ECL, Cat. № 28-9068-38, GE Healthcare). Ожидаемая молекулярная масса 12 kDa (рисунок 7).

Рисунок 7. Результат вестерн-блот анализа содержания Trx-2 в опухолях Отсутствие специфического связывания тестируемого антитела на образце тотальных белковых экстрактов, по-видимому, можно объяснить низкой чувствительностью данных антител и невозможностью в связи с этим идентифицировать низкокопийный белок в тотальном экстракте.

Чтобы увеличить объем наносимого материала, сделали большие карманы, объединили опухолевые и нормальные образцы от 5 пациентов, соответственно, и вместо 10 мкл образца, как в предыдущем эксперименте, на форез нанесли 50 мкл. Провели вестерн-блот-анализ в формате “стрипов”.

Ожидаемая молекулярная масса 12 kDa (рисунок 8).

Рисунок 8. Результат вестерн-блот анализа содержания Trx-2 в опухолях желудка (T) и нормальных образцах эпителия (N) на стрипах Мы предположили, что невыявление специфического связывания анитела к Trx-2 в первом эксперименте может быть обусловлено тем, что они обладают низкой чувствительностью, поэтому увеличили концентрацию антител до 1:500.

Для подтверждения наличия на мембране белка провели вестерн-блот анализ с антителами к Beta-actin (производство Thermo Scientific) в соотношении 1:500 - 6 мкл антител разводили в 3 мл 0.02-кратном блокирующем буфере. На рисунке 3 представлена ожидаемая масса полипептида (отмечено стрелкой), свидетельствующая о наличии бетаактина, а, следовательно, и белка вообще, на исследуемой мембране (рисунок 9).

Рисунок 9. Результаты вестерн-блот анализа содержания -actin в опухолях Затем, на гель был нанесен тотальный экстракт опухолевой и нормальной ткани 4 пациентов.

Описание метода вестерн-блот-анализа с использованием системы SNAP id (Millipore). Разведение антител к Trx-2 - 1:500 - 6 мкл в 3 мл 0.02кратном блокирующем буфере (рекомендовано 1:100-1:1000).

Белковые экстракты, содержащие 15 мкг белка в 15 мкл, подвергали разделению электрофорезом по методу Лэммли в градиентном полиакриламидном геле (10-20%). После разделения белки подвергали электропереносу на поливинил-дифторидную мембрану Immobilon-P Transfer Membrane (Millipore, США), используя mini Trans-Blot transfer cell (Bio-Rad, США) в соответствии с рекомендациями производителя. Мембрану после электропереноса белков смачивали в спирте, затем промывали в воде mQ. В контейнер наливали блокирующий буфер (PBS, 1% Tween-20 и 5% обезжиренное сухое молоко) и блокировали в течение 1 часа. Открывали держатель, смачивали подложку mQ водой, укладывали мембрану белками вниз, разглаживали, удаляли пузыри, затем сверху накладывали сухой спейсер и устанавливали контейнер для сбора раствора антител. Закрывали держатель, переворачивали, устанавливали его в прибор. Заливали раствор первичных антител к Trx-2 (1:500), инкубировали в течение 10 минут, включали насос, откачивали раствор в контейнер, снимали контейнер.

Промывали 3 раза в течение 30 секунд 30 мл PBS с 0,01% Tween-20, при включенном насосе. Заливали вторичные антитела к иммуноглобулинам мыши в соотношении 1: 5 000 (1 мкл антител разводили в 5 мл 0.02-кратном блокирующем буфере), инкубировали 10 минут, включали насос. Затем промывали 3 раза 30 мл PBS-T, при включенном насосе. Мембрану, укладывали в кассету, удаляли лишнюю влагу салфеткой, инкубировали минут с растворами ECL (2 мл раствора А и 50 мкл – раствора В (Amersham ECL Plus™ Western Blotting Detection Reagents, Cat. № RPN2132, GE Healthcare). Затем мембраны экспонировали с рентгеновской пленкой (Amersham Hyperfilm ECL, Cat. № 28-9068-38, GE Healthcare). Ожидаемая молекулярная масса 12 kDa (рисунок 10).

Рисунок 10. Результат вестерн-блот анализа содержания Trx-2 в опухолях желудка и нормальных образцах эпителия 4 пациентов По результатам Вестерн-блот анализа повышенный уровень экспрессии Trx-2 в опухоли отмечается в 3 случаях из 19 (увеличение в 1,2 раза); в случаях наблюдается оверэкспрессия в нормальных образцах (увеличение в 1,1 раза), в оставшихся 14 случаях уровень экспрессии в нормальном и опухолевом образцах не различался. При разделении пациентов на 2 группы по гистологическому типу опухоли на диффузный и интестинальный, различий в экспрессии белка Trx-2 не отмечалось.

2 Клонирование белков (или их фрагментов) в бактериях, синтез и очистка антигена Стратегия выбора белков из списка кандидатов на клонирование (INHBA, GPRC5A, PI3, SOD2, SPARC, GPNMB, Sulf1, THIO) заключалась в отсеве белков, с высокой степенью гомологии с другими белками человека [30]. Таким образом, отбирали только те протеины, которые не имеют гомологичных участков в аминокислотной последовательности и, следовательно, антитела полученные к этим белкам не будут давать неспецифического связывания. Затем оценивали теоретическую антигенность всей аминокислотной последовательности выбранных белков [31] и выявляли фрагмент с наиболее высоким уровнем антигенности.

Нуклеотидную последовательность наиболее переспективного фрагмента для иммунизации клонировали.

Основным критерием отбора белков-кандидатов для дальнейшей наработки в гетерологичных системах экспрессии и получения антител, являлось отсутствие высокой степени гомологии аминокислотной последовательности с другими белками человека (сравнительный анализ был выполнен с помощью ресурса PROTEIN BLAST http://blast.ncbi.nlm.nih.gov).

Дальнейшая работа выполнялась с полипептидами, не имеющими гомологичных участков в аминокислотной последовательности и, следовательно, антитела полученные к ним не должны обладать кроссреактивностью с прочими белками. Для in silico предсказания локализации антигенных детерминант в белках-мишенях, был использован метод [31] антигенности. Нуклеотидную последовательность, содержавшую наиболее переспективный, в иммуногенном отношении, фрагмент, клонировали в плазмидный вектор для последующей продукции рекомбинантного белка.

Материалы и методы исследования. Все процедуры и методы молекулярного клонирования проводили согласно методикам, приведенным в руководстве по методам генной инженерии [32].

Для амплификации фрашментов ДНК был использован Master cycler gradient (Eppendorf), визуализацию гелей проводили с помощью сканера Bio Rad Gel (Bio-Rad), секвенирование плазмидных ДНК выполнено с рекомбинантных белков проводили с использованием колонок HisTrap HP 1ml (GE Healthcare).

Генотипическая характеристика представлена в таблице 11.

Таблица 11. Генетическая характеристика штаммов E.coli Штамм Генотип BL21(DE3) F– ompT gal dcm lon hsdSB(rB- mB-) (DE3 [lacI lacUV5-T7 gene endA1 glnV44 sbcBC rpsL thi-1 (lac-proAB) F'[traD36 proAB+ JM Нуклеотидные последовательности фрагментов белков и дизайн праймеров.

выбраных фрагментов белков- мишеней использовали геномную ДНК (выделенную из лимфоцитов крови здоровых доноров).

AKR1B10 (316 п.н.) atgggctctccggatagaccttgggccaagccagaagacccttccctgctggaggatcccaagattaaggagattgct gcaaagcacaaaaaaaccgcagcccaggttctgatccgtttccatatccagaggaatgtgattgtcatccccaagtctg tgacaccagcacgcattgttgagaacattcaggtctttgactttaaattgagtgatgaggagatggcaaccatactcagct tcaacagaaactggagggcctgtaacgtgttgcaatcctctcatttggaagactatcccttcaatgcagaata INHBA (240 п.н.) сcgaggggcacagcgcggcccccgactgtccgtcctgtgcgctggccgccctcccaaaggatgtacccaactctca gccagagatggtggaggccgtcaagaagcacattttaaacatgctgcacttgaagaagagacccgatgtcacccagc cggtacccaaggcggcgcttctgaacgcgatcagaaagcttcatgtgggcaaagtcggggagaacgggtat PI3 (186 п.н.) ctgtcacgggagttcctgttaaaggtcaagacactgtcaaaggccgtgttccattcaatggacaagatcccgttaaagg acaagtttcagttaaaggtcaagataaagtcaaagcgcaagagccagtcaaaggtccagtctccactaagcctggctc ctgccccattatcttgatccggtgcgcc Анализ нуклеотидных последовательностей искомых фрагментов белков-мишеней проводили с помощью программы Vector NTI 11. Дизайн праймеров, для амплификации ДНК включал расчет наиболее оптимальной структуры олигонуклеотидов, обладающих максимальной гомологией с концевыми участками фрагментов и введение дополнительных нуклеотидов для создания сайтов клонирования (таблица 12).

Таблица 12. Характеристика олигонуклеотидов AKR1B10 5'- agaacatatgggctctccggatagac NdeI-XhoI 3'- acactcgagatattctgcattgaagggatag ctcggatcctcccccaccccaggatccgaggggc 3- ccctgagctcatacccgttctcccgacttt INHBA 5’- aattgagctctcccccaccccaggat SacI-SacI 3- ccctgagctcatacccgttctcccgacttt PI3 5- tccggatccgctgtcacgggagttcctgttaaag BamH-SacI 3ccctgagctcggcgccaccggatcaatataatgggg PI3 5- ttaagagctcgctgtcacgggagttcctgtt SacI-SacI 3-ttttgagctcggcgcaccggatcaata pQE 5- cccgaaaagtgccacctg pET 5- taatacgactcactatagg Полимеразная цепная реакция (ПЦР) состояла из трех стадий:

денатурация двуцепочечной ДНК (94oC, 1 мин), отжига праймеров (40-60oC, 1 мин) и элонгации ДНК-полимеразной реакции (72oC, 1 мин на каждую пар оснований амплифицируемого фрагмента). Температура отжига определялась, как низшая из температур плавления праймеров минус 1-2 oC.

Для оценки температур плавления праймеров каждая GC пара оценивается в 4oC, а AT пара – в 2oC. Дальнейшую очистку ПЦР продуктов проводили с использованием QIAEX II Gel Extraction Kit («Qiagen»).

Конструирование экспрессионных векторов.

интересующих нуклеотидных последовательностей фрагментов белковмишеней были использованы плазмидные векторы pQE31 и pQE («Qiagen»), а также pET21a («Novagen»), генетические карты которых представлены на рисунке 11.

Очищенные ПЦР продукты были клонированы в векторные молекулы ДНК для последующей экспресии: pQE-31 (сайты рестрикции BamHI-SacI);

рQE-32 (сайт рестрикции SacI), pET21a (сайты рестрикции NdeI-XhoI).

Лигирование осуществлялось с помощью фермента ДНК-лигазы фага Т4 в лигазном буфере, следующего состава 66 мМ Трис-Сl, 5 mM MgCl2, 5 mM ДТТ. 0.5 mM ATФ, pH 7.6. Молярная концентрация ДНК вставки превышала концентрацию вектора в 10 раз. Лигирование проводилось при 16 oC в течение 16 часов.

Ampicillin Рисунок 11. Схемы строения экспрессиолнных плазмид (коричневым Трансформация и селекция клеток E.coli. После лигирования вставки и клетки E.coli, штаммов BL21(DE3) и JM10, используя метод теплового шока, ампициллином. Для определения наличия вставки отдельные колонии переносили на новую чашку со средой LB c ампицилином и инкубировали в течение ночи при 37 oC, из полученных культур выделяли плазмидную ДНК и проводили скрининг положительных клонов, с использованием ранее выбранных праймеров. Клетки, содержащие целевую вставку пересевали, а полученные препараты плазмидной ДНК секвенировали.

Оптимизация условий экспрессии белков-мишеней. Оптимизацию экспрессии проводили путем варьирования среды культивирования и условй индукции. Были протестированы следующие среды: LB, SOB (солевая среда с добавками казаминовых кислот), SOC (среда SOB с добавлением глюкозы в качестве энергетического субстрата). Условия индукции были стандартными концентрацию индуктора ИПТГ (в дипазоне концентрации 0,4-1 мМ) и время инкубации клеток до и после индукции. Полученную после культивирования биомассу клеток осаждали центрифугированием при 13000g в течение содержавшем 8М мочевины. Полученные лизаты были использованы для иммунноблота.

Результаты и обсуждение. Эффективная схема постановки ПЦРамплификации искомых нуклеотидных последовательностей (ДНК вставок), позволила оптимизировать молярные соотношения в системе «векторвставка» для достижения максимального уровня интеграции интересующих фрагментов ДНК в плазмиду. Наиболее оптимальным было признано ампициллину клонов представлены на Рисунке 12. ДНК клонов, в которых проведения секвенирования и установления степени идентичности по сравнению с исходной последовательностью.

Векторная система pQE была выбрана, чтобы получить белки, получения С-терминального гексагистидинового тэга (данный тэг позволит с высокой эффективностью и малыми временными затратами выделить и очистить искомые белки от балластных примесей путем аффинной локализованные на 5’-конце мРНК зачастую определяют эффективность синтеза рекомбинантного белка, то полученные генетические конструкции позволяют оценить влияние различных вариантов положения тэга на уровень продукции белка-мишени.

Рисунок 12. Детекция результатов скрининга положительных клонов методом ПЦР (стрелками указаны полосы, соответствующие искомым Вариации питательных сред и условий культивирования не оказали значимого влияния на продукцию интересующих нас белков, также было установлено, что выбранные фрагменты INHBA и PI3 очевидно являются токсичными для клеток, ввиду чего их экспрессия не может быть детектирована (рисунок 13) Рисунок 13. Анализ профилей экспрессии INHBA и PI3 в неочищеных клеточных лизатах (электрофоретическое разделение в 20% ПААГ) 1 – Клетки E.coli трансформированные pBЕ-31 («пустой» вектор), индукция 1 мМ IPTG 2 – Клетки E.coli трансформированных pBЕ-31/INHBA, индукция 0, мМ IPTG 3 – Клетки E.coli трансформированных pBЕ-31/INHBA, индукция 0, мМ IPTG 4 – Клетки E.coli трансформированных pBЕ-31/INHBA, индукция 1 мМ IPTG 5 – Клетки E.coli трансформированные pBЕ-31 («пустой» вектор), индукция 1 мМ IPTG 6 – Клетки E.coli трансформированных pBЕ-31/PI3, индукция 0,4 мМ IPTG 7 – Клетки E.coli трансформированных pBЕ-31/PI3, индукция 0,8 мМ IPTG 8 – Клетки E.coli трансформированных pBЕ-31/PI3, индукция 1 мМ IPTG 9 – Клетки E.coli трансформированных pBЕ-32/INHBA, индукция 1 мМ IPTG 10 – Клетки E.coli трансформированных pBЕ-32/INHBA, индукция мМ IPTG Ввиду возникших трудностей с гетерологичной экспрессией INHBA и PI3, последовательностей всех 3 белков. Проведенный филогенетический анализ аминокислотных последовательностей каждого из белков между различными видами млекопитающих показал, что в случае с INHBA характеризуется высокой степенью гомологии, что значительно затруднит процедуру получения специфических поликлональных антител, ввиду невозможности индукции иммунного ответа на подобный антиген у лабораторных животных (рисунок 14).

Рисунок 14. Филогенетический анализ INHBA множественных дисульфидных связей осложняет формирование корректной третичной структуры в бактериальных системах экспрессии, что возможно обуславливает токсичность данного таргета для экспрессии в бактериальных системах.

Рисунок 15. Филогенетический анализ PI Установлено, что AKR1B10 также является высококонсервативным белком, но в его первичной структуре присутствуют полноценные антигенные детерминанты (рисунок 16).

Рисунок 16. Филогенетический анализ AKR1B Многочисленные методы теоретических предсказаний позволяют выбрать последовательности, обладающие наибольшей антигенностью на основе определенных физико-химических и статистических характеристик участков полипептидной цепи. Учитываются такие свойства как поверхностная доступность, гидрофильность, сегментная подвижность, конфирмационные статистические параметры. С учетом этих параметров нами были выбраны потенциальные антигенные детерминанты для всех белков для последующего клонирования и наработки белка. Ввиду физикохимических и структурных особенностей белков INHBA и PI3 планируется получение синтетических пептидов-миметиков антигенных детерминант для последующего получения антител.

Проведенные нами серии пилотных экспериментов по оптимизации экспрессиии плазмиды pET21a/AKR1B10 в клетках E.coli, штамм BL21(DE3) позволили нам сделать вывод о возможности наработки данного белка в количествах необходимых для дальнейшей иммунизации лабораторных животных (после отработки технологии выделения и очистки целевого белка из лизата (рисунок 17). Была подтверждена высокая специфическая активность высокоафинных антител полученных ранее другими участниками проекта, к белку-мишени. В дальнейшем мы планируем оптимизировать уровень экспрессии AKR1B10 как в бактериальной, так и в бесклеточной белок-синтезирующей системе.

Рисунок 17 Анализ профилей экспрессии AKR1B10 в неочищенном клеточном лизате (электрофоретическое разделение в 12,5% ПААГ и иммунодетекция с высокоафинными поликлональными антителами) 1 – Клетки E.coli трансформированные pET21a/AKR1B10, индукция 0, мМ IPTG 2 – Клетки E.coli трансформированные pET21a/AKR1B10, индукция 0, мМ IPTG 3 – Клетки E.coli трансформированные pET21a/AKR1B10, индукция мМ IPTG В дальнейшем мы планируем оптимизировать уровень экспрессии AKR1B10 как в бактериальной, так и в бесклеточной белок-синтезирующей системе.

3 Оценка экспрессии генов выявленных белков методом ПЦР в реальном времени с обратной транскрипцией у больных раком желудка с опухолями интестинального и диффузного типа Материалы и методы исследования. Материалом для исследования послужили операционный материал рака желудка (РЖ) и образцы нормальной ткани, взятые во время проведения операции. Работа проведена с соблюдением принципов добровольности и конфиденциальности в соответствии с «Основами законодательства РФ об охране здоровья граждан» (Указ Президента РФ от 24.12.1993 № 2288), получено разрешение локального этического комитета института и информированное согласие всех обследованных.

Исследуемая группа 40 больных была разделена по основным клинико-морфологическим характеристикам опухоли: глубина инвазии (T), лимфогенное метастазирование (N), гистологический тип опухоли. Для проведения статистического анализа часть этих подгрупп была организована в классы: Т1-2 и Т3-4, N0 и N1-3 а также, по признаку гистологического типа – в классы больных с диффузным и кишечным гистологическим типом опухоли.

Пациенты со смешанным типом опухоли в исследование не были включены.

Характеристика больных представлена в таблице 13.

замороженных образцов опухоли желудка и нормального эпителия желудка тех же пациентов.

Таблица 13 Клинико-патологическая характеристика больных РЖ Примечания 1 классификация TNM 2 T – первичная опухоль 3 N – лимфогенное метастазирование 4 M – гематогенное метастазирование Выделение РНК. Нормальная ткань подвергалась исследованию для подтверждения отсутствия опухолевых клеток. После резекции опухоли образцы максимально быстро помещались в жидкий азот и далее хранились при -80°С. Собранные образцы тканей гомогенизировали с помощью шаровой мельницы Sartorius Mikro Dismembrator U (Eppendorf) при об/мин в течение 60 сек и охлаждении жидким азотом. Суммарную РНК из опухоли выделяли с помощью набора RNasy mini Kit (Qiagen, Inc). Качество выделенной РНК оценивали электрофоретически по наличию выраженных бендов 28S и 18S рибосомальной РНК (рисунок 18). Концентрацию и чистоту РНК оценивали на спектрофотометре NanoDrop-2000 (Termo Scientific, USA), пример количественной оценки представлен на рисунке 19 (данный образец был выделен с помощь набора RNasy mini Kit (Qiagen, Inc). На рисунке видны концентрации РНК от 20-52 нг/мкл и чистота А280/А260 нм = 2,00-2, А260/А230 нм = 1,90-2, Рисунок 18. Электрофореграмма тотальной РНК, выделенной RNasy mini Kit (Qiagen, Inc) из опухоли желудка (1). Маркер молекулярной массы (2) 100bp.

Видны бенды: 28 S b 18 S рибосомальной РНК 28S/18S Рисунок 19. Концентрация РНК в образцах, выделенных из опухоли больных до лечения 20-52 нг/мкл, соотношения А260/А280= 2,00-2,05 и А260/А230= Оценка экспрессии генов. Экспрессию исследуемых генов оценивали с помощью метода обратной транскрипции и ПЦР в режиме реального времени. Для получения кДНК на матрице РНК проводили реакцию обратной транскрипции с помощью набора RevertAidtm (K1622) (Ферментас, Литва). Далее с полученной кДНК проводилась ПЦР в режиме реального времени. Реакционная смесь на 1 пробу (общий объём 15 мкл) содержит: 1, мкл буфера для Taq-полимеразы 10-ти кратного (160 mM (NH4)2SO4, 670 mM полимеразой)), 1,5 мкл кДНК, 0,75 мкл 50mM MgCl2, 1,5 мкл 2,5 mM dNTP (Сибэнзим, Россия), 0,1 мкл Taq ДНК-полимеразы E338 (Сибэнзим, Россия), по 1мкл каждого из праймеров с концентрацией 10 пмоль/мкл, 1мкл зонда с концентрацией 10пмоль/мкл и вода milliQ до 15 мкл. Сверху наслаивалось для предотвращения испарения 15мкл минерального масла Ultra Pure Grade (Медиген, Россия). Для проведения ПЦР применяли пробирки на 0,2 мл (Axygen, USA). Готовили пробирки с праймерами и зондом, в которые добавляли реакционную смесь (из общего пула) вместе с матрицей.

Реакционную смесь раскапывали по 12 мкл в пробирки. 2х-шаговая программа на амплификаторе состоит из следующих этапов: 1 цикл – 94оС в течении 2х минут для предварительной денатурации; 42 цикла – 94оС в течении 12 сек и 61оС в течении 25 сек с оценкой интенсивности флуоресценции на длине красителя Относительный уровень экспрессии (по отношению к гену рефери ACTB) оценивался по методу Сt с помощью программы Rotor-Gene 6000 Series Software 1.8 (Build 11), ISO 9001:2000 (Reg № QEC21313).

Рисунок 20. Окно программы Rotor-Gene 6000 Series Software 1.8(Build 11) с отображением кривых флуоресценции исследуемых генов Последовательность праймеров и зондов (FAM) подбирали при помощи программы Oligo Analysis Vector NTI 9.0 с использованием генетического банка данных www.ncbi.nlm.nih.gov. Использовали следующие праймеры и зонды оригинального дизайна:

thioredoxin TXN(Trx) Forward Primer 5’-GTGAAGCAGATCGAGAGCAAG-3’ Reverse Primer 5’-CGTGGCTGAGAAGTCAACTACTA-3’ FAM 5’-CTTGGACGCTGCAGGTGATAAACT-3’BHQ Forward Primer 5'-GAGACGTGCGAGAAACTCAAG-3’ Reverse Primer 5’-TGGTACTGGCACTCCTCAATG-3’ FAM 5’-AGATGTGCAAGCGGAACCTGGAAG-3’BHQ Forward Primer 5’-TGTTCCAGAGCATGGAGATCA-3’ Reverse Primer 5’-GTGCAGACAGCTTGTAGTGG-3’ Probe FAM 5’-CATCGTGGTGGTGATGATGGTGATG-3’BHQ HSPG Forward Primer 5’-AGTTCCGATGCGTCTCTACC-3’ Reverse Primer 5’-CTCTCCTCGTCACAGTGGA-3’ Probe FAM 5’-AACATGTGCATCCCAGCCAGC-3’BHQ CTGF Forward primer 5’-GCAGGCTAGAGAAGCAGAGC -3’ Reverse primer 5’-ATGTCTTCATGCTGGTGCAG -3’ Probe FAM 5’-TGCGAAGCTGACCTGGAAGAGAACA -3’BHQ EFEMP Forward Primer 5’-CACTGACGGATATGAGTGGGA-3’ Reverse Primer 5’-GTTGACACACTTCATTCCACCTT-3’ Probe FAM 5’-ATGAATGTGACATTGTCCCAGACGCT-3’BHQ FGF Forward Primer 5’-CGAAAACAGCGACTACACTCT-3’ Reverse Primer 5’-TAGCCTTCACTCCTTGGATGG-3’ Probe FAM 5'-CCGTGGGCCTGCGTGTAGT-3’BHQ ACTB Forward primer 5’-GATCATTGCTCCTCCTGAGC-3’ Reverse primer 5’-ACTCCTGCTTGCTGATCCAC-3’ FAM 5’-CTCGCTGTCCACCTTCCAGCAGAT-3’BHQ Статистическую обработку материала проводили с помощью пакета программ “STATISTICA 6.0”. Сравнение уровня экспрессии генов проводили с помощью непараметрического критерия Уилкоксона-Манна-Уитни.

Результаты и обсуждение. В ходе проделанной работы был определен уровень экспрессии генов TXN, WNT4, PMEPA1, HSPG2, CTGF, EFEMP1 и FGF12 в опухоли желудка и парном нормальном желудочном эпителии больных РЖ.

В результате сравнения уровня экспрессии указанных генов в опухолевой и нормальной ткани желудка относительно гена-рефери ACTB в общей группе больных, повышенная экспрессия относительно нормальной ткани установлена только для гена PMEPA1 (p0,0001) (таблица 14). Причем разделение группы больных на классы в зависимости от основных клиникоморфологических характеристик опухоли не влияло на результаты данного анализа. Относительная экспрессия данного гена была в среднем более чем в 2 раза выше в опухолевой ткани желудка у 57,5% пациентов (таблица 15).

При сравнении уровня экспрессии генов TXN, WNT4, HSPG2, CTGF, EFEMP и FGF12 в общей группе больных, статистически-значимых различий показано не было (p0,05).

Таблица 14. Уровень экспрессии генов TXN, WNT4, HSPG2, CTGF, EFEMP1 и FGF12 в общей группе Примечание - при проведении статистического анализа для сравнения представленных классов в таблице 2, а также в таблицах 4, 7, 8, 10 и применялся U-тест Манна-Уитни.

Таблица 15. Дифференциальная экспрессия генов TXN, WNT4, HSPG2, CTGF, EFEMP1 и FGF12 на индивидуальном уровне в общей группе Гены Увеличение Уменьшение Ген PMEPA1(STAG1, TMEPAI) локализован в 20 хромосоме, 20q13.31q13.33 (рисунок 21). Продуктом данного гена является трансмембранный белок, индуцируемый андрогенами, определяющий один из механизмов регуляции этими гормоном некоторых генов. [33]. Выявили, что данный ген наиболее активно экспрессируется в клетках простаты и (менее выражено) матки. Синтезируется 8 транскриптов. Основной продукт состоит из 287 АК.

Молекулярный вес - 31,5 kDa.

Вовлеченность данного гена в канцерогенез можно трактовать неоднозначно. С одной стороны, экспрессия данного гена в ткани предстательной железы (место наибольшей активности данного гена) индуцируется тестостероном и снижена при раке предстательной железы РПЖ [34]. С другой стороны, прослеживается явная взаимосвязь работы гена PMEPA1 и ростового фактора TGF при других локализациях (РМЖ, рак желудочно-кишечного тракта (рисунок 22), рак яичника и почки), при ингибирование действия PMEPA1 (при РМЖ) приводит к угнетению промоторного эффекта TGF на опухоль. В этой связи было сделано предположение, что PMEPA1, по крайней мере, при РМЖ, играет роль действия TGF (онкоген/супрессор) на ткань [38].

Рисунок 22. Кривая Каплана-Мейера сравнения выживаемости пациентов, характеризующихся наличием (серая линия) и отсутствием (черная) повышенной экспрессии любого из пяти следующих генов:

В случае рака предстательной железы подобного явления не тестостероном и стимулирует, в свою очередь, деградацию данного гормона, формируя отрицательно-обратную связь [34] и, по видимому, играя роль супрессорного механизма по отношению к опухоли. Было показано, что уровень экспрессии данного гена при раке простаты снижен [40, 41].

Иная картина наблюдается при раке толстой кишки. Авторы, исследуя супрессорную активность TGF, показали повышение уровня экспрессии гена PMEPA1 в ответ на воздействие на культуру клеток TGF (этот ростовой фактор играет важную роль в процессе дифференцировки колоноцитов). Повышенная экспрессия PMEPA1 наблюдается в опухолевой ткани и может стимулировать дифференцировку опухоли [35].

Далее нами был проведен анализ уровня экспрессии изучаемых генов в группах больных с диффузным и интестинальным гистологическим типом рака желудка. Уровень экспрессии гена PMEPA1 по сравнению с нормой был значимо повышен только в группе больных с интестинальный типом РЖ (p0,001) (таблица 17). В этой группе более чем двукратное повышение уровня экспрессии PMEPA1 наблюдалось у 75% больных против 31,5% в группе с диффузным типом опухоли (таблица 18). В последнем случае можно говорить лишь о тенденции к повышению уровня экспрессии PMEPA (p=0,057).

Помимо этого, диффузный тип РЖ характеризовался повышением уровня экспрессии гена FGF12 (p0,05) (таблица 16). Более чем двукратная разница по данному показателю регистрировалась у 62,5% больных (25% в группе с интестинальным типом) (таблица 16).

FGF12 (также известный как FHF1и FGF12B) локализован в хромосоме, 3q28 (рисунок 23).

Белковый продукт является членом семейства факторов роста фибробластов FGF. Члены данного семейства вовлечены в регуляцию множества митогенных процессов, клеточной выживаемости, а также эмбрионального развития, клеточного роста, морфогенеза, регенерации, опухолевого роста и инвазии. FGF12, в отличие от прочих членов данного семейства, лишен N-концевой сигнальной последовательности, но содержит кластеры щелочных аминокислот, которые проявляют свойства ядерного сигнального элемента. При трансфекции гена в клетки млекопитающих белок накапливается в ядре и не секретируется. Специфическая функция FGF еще не определена.

Белки семейства FGF содержат от 150 до 268 АК, и имеют общий консервативный центральный регион размером около 140 аминокислот [42].

На сегодняшний день открыты 4 FGF рецептора: FGFR1-FGFR4.

Основной транскрипт подвергается альтернативному сплайсингу, транслицируясь в виде 2х изоформ [43].

Как уже был указано выше, точная специфическая функция FGF12 еще не выяснена, однако, ввиду серьёзной функциональной нагрузки на остальных членов семейства FGF, в различных направлениях ведутся работы по её определению. Работ, имеющих четкие результаты, связывающие экспрессию FGF12 с канцерогенезом, не так много. В частности, выявлено, что комплексное повышение экспрессии ряда генов в культуре клеток U глиомы человека (в их число входит и FGF12) приводит к активации клеток эндотелия HUVEC, т.е. может быть направлено на интенсификацию ингибирующий эффект оверэкспрессии этого гена на апоптоз [45], т.е.

данные свидетельствуют о потенциальной онкогенной роли FGF12, что не объясняет полученные нами результаты о дифференциальной экспрессии FGF12 при РЖ диффузного гистологического типа.

Таблица 16. Уровень экспрессии генов TXN, WNT4, HSPG2, CTGF, EFEMP и FGF12 в опухолевой и нормальной ткани желудка больных с диффузным типом опухоли Продолжение таблицы Примечание - * - значимость различий между группами диффузный и интестинальный Таблица 17. Уровень экспрессии генов TXN, WNT4, HSPG2, CTGF, EFEMP и FGF12 в опухолевой и нормальной ткани желудка больных с интестинальным типом опухоли При сравнении групп больных с диффузным и интестинальным гистологическим типом между собой, было выявлено статистическизначимое повышение уровня экспрессии гена CTGF в опухолях диффузного типа (таблицы 16, 17). CTGF (CCN2; NOV2; HCS24; IGFBP8; MGC102839 connective tissue growth factor, ростовой фактор соединительной ткани) локализован в 6 хромосоме, 6q23.1 (рисунок 24) и представляет из себя ген одного из шести членов белкового семейства CCN.

Это имя было дано данной группе белков по названиям первых трех из открытых её членов: CYR61 (CCN1), CTGF (CCN2) и NOV(ССN3). Остальные гены данной группы: WISP1 (ELM1, CCN4), WISP2 (COP-1, CCN5) и WISP (CCN6). Разные белки из данного семейства обладают схожей вторичной структурой, заключающейся в наличии пяти одинаковых индивидуальных функциональных доменов [46, 47, 48]. Эти белки обладают широким спектром функций, зависящим от их клеточного микроокружения [48, 49] а также меняющимся в процессе взаимодействий их доменов [48, 50].

Таблица 18. Дифференциальная экспрессия генов TXN, WNT4, HSPG2, CTGF, EFEMP1 и FGF12 при различных гистотипах РЖ CTGF имеет молекулярную массу 38kDa и первоначально стал известен как ростовой фактор, секретируемый клетками эндотелия сосудов человека [48, 51] и описанный, как хондроцито-специфический белок [48, 52, 53]. Его экспрессия повышается при ряде фиброзных нарушений, таких как фиброзы склеродермы, почек и печени [47, 48, 54, 55, 56]; конститутивная экспрессия CTGF является признаком различных патологических процессов [48, 57]. CTGF ответственен за пролиферацию, миграцию, выживаемость клеток и адгезию при ангиогенезе [48, 58]. Более того, активность данного гена очень быстро изменяется при воздействии различных ростовых факторов, непосредственно индуцируется ими и, по всей видимости, играет важную роль в контроле пролиферации [48, 59]. В промоторном участке гена CTGF имеется сайт связывания Smad и элементы связывания TGF [48, 56, 60].

В литературе содержится множество данных о роли CTGF в патогенезе различных злокачественных опухолей (РМЖ, рака желудка, поджелудочной железы, рака яичников, глиобластомы и др), как правило, экспрессия в опухоли понижена. Было выявлено, что повышение экспрессии гена CTGF в опухоли различных локализаций ассоциировано с ангиогенезом первичной опухоли, метастазированием, ухудшением прогноза и показателей общей выживаемости пациентов [61-67]. Кроме того, по некоторым данным, повышенная экспрессия CTGF играет роль в лекарственной устойчивости опухоли [68, 69], характерна для ранней стадии течения заболевания и в ряде случаев может служить маркером развития злокачественных новообразований [70].

В подгруппе с интестинальным гистотипом отмечено достоверное снижение экспрессии гена WNT4 в опухолевой ткани, по сравнению с нормальным желудочным эпителием (таблица 17), и экспрессия этого гена снижена у 50 % больных (таблица 18). Ген WNT4 (синонимы: WNT-4;

SERKAL) локализован в 1 хромосоме 1p36.23-p35.1 (рисунок 25).

Семейство WNT состоит из генов, кодирующих секретируемые сигнальные белки. Эти белки вовлечены в канцерогенез, детерминацию клеток и эмбриогенез. WNT4 – член данного семейства, для которого впервые было показано влияние на определение пола. Белок WNT4 имеет 98% гомологии с аналогичным белком крысы и мыши. Совместно с WNT2 и WNT7B он ассоциирован с аномальным уровнем пролиферации клеток молочной железы, наследственные мутации WNT4 связаны с риском развития рака молочной железы и рака яичников. В норме WNT4 регулирует пролиферацию стволовых клеток молочной железы под действием прогестерона, а его транскрипт 2,5 kb играет существенную роль в эмбриональном развитии [71, 72].

Изменение уровня экспрессии данного гена при канцерогенезе зависит от локализации опухоли. В различных исследованиях показано как значимое повышение (лейкемия, рак надпочечников, рак эндометрия аденома гипофиза, рак молочной железы), так и понижение его экспрессии в опухоли по сравнению с нормальной тканью (рак толстого кишечника, рак мочевого пузыря) [71-77].

При разделении группы больных на подгруппы с наличием (N1-N3) и отсутствием (N0) метастазов в регионарные лимфоузлы, в опухоли, по сравнению с соответствующим нормальным эпителием желудка наблюдалось повышение уровня экспрессии генов PMEPA1 и CTGF только в группах N1-N3 (p0,001 и 0,005 соответственно) (таблица 19). В обеих подгруппах понижение уровня экспрессии гена PMEPA1 на индивидуальном уровне в опухоли по сравнению с нормой не выявлено ни у одного больного (таблица 19). Более чем двукратное повышение экспрессии генов PMEPA1 и CTGF регистрировалось у 54,55% (N1-N3) и 57,14% (N0) пациентов по первому гену и 40,91% и 14,29% по второму соответственно (таблица 20).

Повышение уровня экспрессии генов PMEPA1 и CTGF в группе N проявлялось только в виде тенденции и значимого уровня различий не достигло (таблица 20). В целом наши данные свидетельствуют в пользу того, что регионарное метастазирование оказывает влияние только на дифференциальную экспрессию генов PMEPA1 и CTGF, поскольку при сравнении подгрупп больных N0 и N1-N3 значимых различий по уровню экспрессии исследуемых генов не установлено (данные не представлены).

Таблица 19. Уровень экспрессии генов TXN, WNT4, HSPG2, CTGF, EFEMP и FGF12 в опухолевой и нормальной ткани желудка больных с наличием метастазов в регионарные лимфоузлы N1-N3 (n=22) Соответствующая норма (n=22) Таблица 20. Уровень экспрессии генов TXN, WNT4, HSPG2, CTGF, EFEMP и FGF12 в опухолевой и нормальной ткани желудка больных с отсутствием метастазов в регионарные лимфоузлы Таблица 21. Дифференциальная экспрессия генов TXN, WNT4, HSPG2, CTGF, EFEMP1 и FGF12 на индивидуальном уровне TXN 1(7,14%) 3(21,43%) 10(71,43%) 5(22,73%) 3(13,64%) 14(63,64%) WNT4 3(21,43%) 5(35,71%) 6(42,86%) 4(18,18%) 7(31,82%) 11(50%) EFEMP1 2(14,29%) 6(42,86%) 6(42,86%) 7(31,82%) 4(18,18%) 11(50%) FGF12 5(35,71%) 6(42,86%) 3(21,43%) 10(45,45%) 4(18,18%) 8(36,36%) На уровне тенденции у больных с отсутствием регионарного метастазирования (N0) отмечается сниженный уровень экспрессии гена HSPG2 в опухоли, по сравнению с нормой (таблица 20) и у ни одного пациента из этой подгруппы не установлено увеличение экспрессии HSPG2, в то время как в подруппе с наличием метастазов в регионарные лимфоузлы (N1-N3) у 18% больных встречалось повышение дифференциальной экспрессии HSPG2 (таблица 21). HSPG2 (синонимы: PLC; SJA; SJS; HSPG;

SJS1; PRCAN), также как и WNT4 локализован в 1 хромосоме 1, 1p36.1-p (рисунок 26).

гликопротеид (молекулярный вес - 468 kDa, содержит 4391 аминокислот), состоящий из центральной коровой белковой части и трёх длинных происходит связывание перликана со многими элементами матрикса и мембранными молекулами (такими, как ламинин, пролангин, коллаген IV типа, FGFBP1, FBLN2, FGF7 и др.) и таким образом оказывает огромное влияние на многие клеточные процессы. Перликан – ключевой компонент экстрацеллюлярного матрикса сосудов, где его функция направлена на поддержание функционирования эндотелиального барьера. Кроме того, он является ингибитором пролиферации клеток гладкой мускулатуры, стимулятором работы некоторых ростовых факторов (например, FGF2), и, посредством этого – регенерации и пролиферации эндотелиальной ткани.

Перликан – основной компонент базальных мембран, где он участвует в стабилизации других макромолекул и в регуляции клеточной адгезии. Весьма консервативный гликопротеид, показывающий большую степень межвидовой гомологии [30].

В аспекте канцерогенеза HSPG2 чаще рассматривают в качестве регулятора ангиогенеза. Причем в данной ипостаси роль его неоднозначна.

Перликан может как стимулировать [78, 79, 80], так и ингибировать ангиогенез [81], оказывая, таким образом и на опухоль как индуцирующее, так и супрессорное действие. Наши данные свидетельствуют скорее о стимулирующем действии перликана, поскольку при лимфогенном метастазировании экспрессия его в опухоли повышается и на уровне тенденции (p=0,07) экспрессия HSPG2 в опухоли больных N1-N3 выше почти в полтора раза, чем в опухоли больных N0.

Далее нами было показано, что подгруппы с низкой (T1-T2) и высокой (T3-T4) глубиной инвазии характеризуются значимо более высоким уровнем экспрессии гена PMEPA1 в опухоли по сравнению с нормальной тканью (p=0,001-0,002) (таблицы 22, 23). При этом между собой по уровню экспрессии исследуемых генов эти подгруппы не различались (данные не представлены). Это свидетельствует о том, что глубина инвазии не оказывает значимого влияния на экспрессию гена PMEPA1. Дифференциальная экспрессии гена PMEPA1 в подгруппах T1-T2 и T3-T4 была сходной, более чем двукратное повышение данного показателя в опухолевой ткани по сравнению с нормой наблюдалось у 55,6% больных (таблица 24).



Pages:   || 2 |
Похожие работы:

«ЭРЖАНОВ МАКСУД ОТАБАЕВИЧ РАЗРАБОТКА АЛГОРИТМОВ И ПРОГРАММНОГО ОБЕСПЕЧЕНИЯ ПОСТРОЕНИИ ГЕОМЕТРИЧЕСКИЕ ФРАКТАЛОВ НА БАЗЕ R-ФУНКЦИИ Специальность: 5А521902 – Управление и обработка информации. ДИССЕРТАЦИЯ На соискание академической степени магистра Работа рассмотрена Научный руководитель и допускается к защите проф., д.ф.-м.н. Назиров Ш.А. зав. кафедрой ИТ _ Джайлавов А.А. _ _ _ 2012г....»

«Государственное образовательное учреждение высшего профессионального образования Российский государственный университет нефти и газа им. И. М. Губкина Департамент оперативного управления реализацией программы НИУ АННОТАЦИЯ 3.3.3/2 Разработка программ магистерской подготовки Автоматизированные системы диспетчерского управления в нефтегазовом комплексе, реализуемой в соответствии с ПНР университета Москва 2011 3 Программа развития государственного образовательного учреждения высшего...»

«Министерство образования и науки Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Амурский государственный университет Кафедра общей математики и информатики УЧЕБНО-МЕТОДИЧЕСКИЙ КОМПЛЕКС ДИСЦИПЛИНЫ СОВРЕМЕННЫЕ ИНФОРМАЦИОННЫЕ ТЕХНОЛОГИИ В СОЦИАЛЬНЫХ НАУКАХ Основной образовательной программы по направлению подготовки 040100.62 – Социология Благовещенск 2012 УМКД разработан доцентом, канд. пед. наук Чалкиной Натальей...»

«Министерство образования и науки Российской Федерации Московский государственный университет печати В.М. Гасов, А.М. Цыганенко ТРЕХМЕРНАЯ ГРАФИКА В МЕДИАИНДУСТРИИ Учебник Допущено УМО по образованию в области полиграфии и книжного дела для студентов высших учебных заведений, обучающихся по специальностям: 230102.65 – Автоматизирование системы обработки информации и управления; 230200.65 – Информационные системы; 074100.65 – Информационные системы в медиаиндустрии Москва 2010 УДК 004.92 ББК...»

«Министерство образования и наук и России Московский государственный университет им. М.В. Ломоносова Российская Академия Наук Научно методический совет по информатике при Министерстве образования и науки России Совещание Актуальные проблемы информатики в современном российском образовании Москва, июнь 2004 г. 2 Ответственные редакторы: Председатель НМС по информатике, академик РАН Ю.И. Журавлев, ученый секретарь НМС по информатике доцент В.В. Тихомиров 1-ое Всероссийское совещание НМС по...»

«Государственный комитет по науке и технологиям Республики Беларусь ГУ Белорусский институт системного анализа и информационного обеспечения научно-технической сферы Молодежный инновационный форум ИНТРИ – 2010. Материалы секционных заседаний 29–30 ноября 2010 г. Минск 2010 УДК 001 (063)(042.3) ББК 72.4 М 34 Под общей редакцией д-ра техн. наук И. В. Войтова М 34 Материалы секционных заседаний. Молодежный инновационный форум ИНТРИ – 2010. — Минск: ГУ БелИСА, 2010. — с. ил., табл. с.: ISBN...»

«Министерство образования и науки Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Амурский государственный университет Кафедра математического анализа и моделирования УЧЕБНО-МЕТОДИЧЕСКИЙ КОМПЛЕКС ДИСЦИПЛИНЫ Основы информатики и архитектура компьютеров Основной образовательной программы направления 010400.62 прикладная математика и информатика Благовещенск 2012 г. УМКД разработан доцентом Труфановым Виктором...»

«050501.65 - Профессиональное обучение Обучение ведется по ГОС ВПО 050501.65 - Профессиональное обучение (информатика, вычислительная техника и компьютерные технологии), утвержденный 27.03.2000г №237 Квалификация выпускника – педагог профессионального обучения. Нормативный срок 5 лет. Квалификационная характеристика выпускника Педагог профессионального обучения должен: • иметь представление: -о локальных, системных, приборных интерфейсах и интерфейсах периферийных устройств; - о системах...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ СОГЛАСОВАНО: УТВЕРЖДАЮ: Первый Заместитель Министра Заместитель Министра Российской Федерации по связи образования Российской Федерации и информатизации В.Д. Шадриков Ю.А. Павленко 10.03.2000 г. 23.02.2000 г. Регистрационный номер 19тех/маг ГОСУДАРСТВЕННЫЙ ОБРАЗОВАТЕЛЬНЫЙ СТАНДАРТ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ Направление 210400 Телекоммуникации Степень (квалификация) - магистр техники и технологии Вводится с момента утверждения Москва 2000...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное агентство по образованию Государственное образовательное учреждение высшего профессионального образования Новосибирский государственный университет (НГУ) Кафедра общей информатики Е.Н. Семенова РЕАЛИЗАЦИЯ ТЕХНОЛОГИИ ЗАЩИЩЕННОГО ОБНОВЛЕНИЯ ПРОГРАММНЫХ СИСТЕМ ПО СЕТИ МАГИСТЕРСКАЯ ДИССЕРТАЦИЯ по направлению высшего профессионального образования 230100.68 ИНФОРМАТИКА И ВЫЧИСЛИТЕЛЬНАЯ ТЕХНИКА ФАКУЛЬТЕТ ИНФОРМАЦИОННЫХ ТЕХНОЛОГИЙ Тема...»

«Министерство образования и науки Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Амурский государственный университет Кафедра математического анализа и моделирования УЧЕБНО-МЕТОДИЧЕСКИЙ КОМПЛЕКС ДИСЦИПЛИНЫ Теория вероятностей и математическая статистика Основной образовательной программы по специальности 160400.65–Проектирование, производство и эксплуатация ракет и ракетно-космических комплексов Благовещенск 2012 г....»

«Министерство образования и науки Российской Федерации Федеральное агентство по образованию Государственное образовательное учреждение высшего профессионального образования Тобольский государственный педагогический институт им. Д.И.Менделеева Кафедра информатики и методики преподавания информатики УЧЕБНО-МЕТОДИЧЕСКИЙ КОМПЛЕКС ПО ДИСЦИПЛИНЕ КОМПЬЮТЕРНЫЕ НАУКИ направление 010200.62 – Математика. Прикладная математика специализация Компьютерная математика УМК составила: ст. преподаватель Оленькова...»

«2 3 СОДЕРЖАНИЕ Пояснительная записка 4с. Структура и содержание дисциплины 9с. Объем дисциплины и виды учебной работы 9с Тематический план лекций 10с Тематический план практических занятий и семинаров 10с Содержание лекций 11с Содержание практических занятий и семинаров 14с Критерии балльно-рейтинговой оценки знаний студентов 16с Самостоятельная работа студентов (аудиторная и внеаудиторная). 17с Учебно-методическое и информационное обеспечение дисциплины 20с Основная литература 20с...»

«До И ин ст ссл те ф иж ед ме ле ор е ова ж ко ма ни ни ду мм ти я е на у за в с ро ни ци фе дн ка и ре ой ци и бе й в зо ко па н сн тек ос с т ти е 33 asdf Организация Объединенных Наций РАЗОРУЖЕНИЕ Управление по вопросам разоружения Доклад Группы правительственных экспертов по достижениям в сфере информатизации и телекоммуникаций в контексте международной безопасности asdf Организация Объединенных Наций Нью-Йорк, 2012 год Руководство для пользователей Настоящее издание, имеющееся на всех...»

«АНАЛИЗ РАБОТЫ ГОСУДАРСТВЕННОГО БЮДЖЕТНОГО ОБРАЗОВАТЕЛЬНОГО УЧРЕЖДЕНИЯ ГОРОДА МОСКВЫ МОСКОВСКАЯ МЕЖДУНАРОДНАЯ ГИМНАЗИЯ ЗА 2011/2012 УЧЕБНЫЙ ГОД ПЕДАГОГИЧЕСКИЕ КАДРЫ ГИМНАЗИИ ПЕДАГОГИЧЕСКИЕ КАДРЫ ГИМНАЗИИ В 2011/2012 учебном году в педагогический состав гимназии входило 122 человека. С целью улучшения научно-методического обеспечения учебно-воспитательного процесса в гимназии работали следующие кафедры: · Кафедра иностранного языка (зав.кафедрой – Сальникова Л.Т.) - 23 человека (19%). Из них...»

«ФЕДЕРАЛЬНОЕ АГЕНТСТВО ПО ОБРАЗОВАНИЮ Государственное образовательное учреждение высшего профессионального образования Южно-Российский государственный университет экономики и сервиса (ГОУ ВПО ЮРГУЭС) Волгодонский институт сервиса (филиал) ЮРГУЭС ИНФОРМАЦИОННЫЕ СИСТЕМЫ И ТЕХНОЛОГИИ. ТЕОРИЯ И ПРАКТИКА Сборник научных трудов ШАХТЫ Издательство ЮРГУЭС 2008 УДК 004 ББК 32.97 И741 Редакционная коллегия: А.Н. Берёза, к.т.н., доцент (председатель редакционной коллегии); Д.А. Безуглов, д.т.н., профессор;...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Филиал федерального государственного бюджетного образовательного учреждения высшего профессионального образования Кемеровский государственный университет в г. Анжеро-Судженске 1 марта 2013 г. РАБОЧАЯ ПРОГРАММА по дисциплине Безопасность жизнедеятельности (ЕН.Р.1) для специальности 080801.65 Прикладная информатика в экономике факультет информатики, экономики и математики курс: 1 семестр: 1 зачет: 1 семестр лекции: 18 часов практические...»

«Уход за детьми Первого года жизни Справочник для молодых родителей Данное издание предназначено для молодых родителей. В нем можно найти советы по уходу за ребенком в течение первого года жизни, рекомендации о том, что делать при первых заболеваниях, что делать и куда обращаться за помощью, информацию о службах и услугах Региональной Санитарной Службы, о присутствии культурных посредников-переводчиков в Семейных консультациях и Отделениях, помогающих молодым мамам-иностранкам и семьям...»

«2 Программа разработана на основе ФГОС высшего образования по программе бакалавриата 01.03.02 Прикладная математика и информатика. Объектами профессиональной деятельности магистра прикладной математики и информатики являются научно - исследовательские центры, государственные органы управления, образовательные учреждения и организации различных форм собственности, использующие методы прикладной математики и компьютерные технологии в своей работе. Магистр прикладной математики и информатики...»

«И.Ф. Астахова А.П. Толстобров В.М. Мельников В ПРИМЕРАХ И ЗАДАЧАХ УДК 004.655.3(075.8) ББК 32.973.26-018.1я73 Оглавление А91 Рецензенты: Введение 8 доцент кафедры АСИТ Московского государственного университета Н.Д. Васюкова; Воронежское научно-производственное предприятие РЕЛЭКС; 1. Основные понятия и определения 10 кафедра информатики и МПМ Воронежского 1.1. Основные понятия реляционных баз данных государственного педагогического университета; 1.2. Отличие SQL от процедурных языков...»





Загрузка...



 
© 2014 www.kniga.seluk.ru - «Бесплатная электронная библиотека - Книги, пособия, учебники, издания, публикации»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.